Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 4538

1.

rs796998038 [Homo sapiens]
    ACATATTTTCCATTCCAGTAGGAAC[C/T]TCCTGGATGCTCTGTGTCATGCTGT
    Chromosome:
    15:43672191
    Validated:
    no info
    HGVS:
    NC_000015.10:g.43672191T>C, NC_000015.9:g.43964389T>C, NG_029358.2:g.12637A>G, XM_005254193.1:c.-49+37593A>G
    2.

    rs796987798 [Homo sapiens]
      GAGAGCTGCTTGGCTGTAGAACAGT[A/G]GGAAGGAAGGAAGAAGAATTCGGCT
      Chromosome:
      15:43700513
      Validated:
      no info
      HGVS:
      NC_000015.10:g.43700513G>A, NC_000015.9:g.43992711G>A, NG_029359.1:g.17850C>T, XM_005254193.1:c.-49+9271C>T
      3.

      rs796963064 [Homo sapiens]
        TTTCTTTTTCTTTCTTTCTTTTTTT[C/T]TTTTTTTTTTTTTGAGATGGAGTAT
        Chromosome:
        15:43638294
        Gene:
        CATSPER2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        no info
        HGVS:
        NC_000015.10:g.43638294T>C, NC_000015.9:g.43930492T>C, NG_009283.1:g.15548A>G, NM_001282309.1:c.842+610A>G, NM_001282310.1:c.860+610A>G, NM_054020.3:c.842+610A>G, NM_172095.2:c.842+610A>G, NR_110319.1:n.844+610A>G, XM_005254193.1:c.-48-19524A>G, XM_017021904.1:c.842+610A>G
        4.

        rs796944044 [Homo sapiens]
          ACTTAAAGTATTAAAAAAAAAAAAA[-/A]GAACAGCTTTTGGATTTACCCTGAG
          Chromosome:
          15:43656003
          Validated:
          no info
          HGVS:
          NC_000015.10:g.43656003delA, NC_000015.9:g.43948201delA, XM_005254193.1:c.-48-37233delT
          6.

          rs796925288 [Homo sapiens]
          • Suspected
          ACTGCTCAACACAAGTTACTCACTG[C/T]AGATTCCTGAGGGTCAGGTTGGTGG
          Chromosome:
          15:43708750
          Validated:
          no info
          HGVS:
          NC_000015.10:g.43708750T>C, NC_000015.9:g.44000948T>C, NG_029359.1:g.9613A>G, XM_005254193.1:c.-49+1034A>G
          8.

          rs796854550 [Homo sapiens]
            CTCAATTCCTCCCTCCCCAACCCCC[CA/TG]GAAACCACTAATCTACTTTCTGTCT
            Chromosome:
            15:43628480
            Validated:
            no info
            HGVS:
            NC_000015.10:g.43628480_43628481delCAinsTG, NC_000015.9:g.43920678_43920679delCAinsTG, XM_005254193.1:c.-48-9711_-48-9710delTGinsCA
            10.

            rs796811707 [Homo sapiens]
              AGAACCCAAAAAAACCCCCCAAAAA[A/C]CTAATTAAGGCCAATTGTAGTGGCT
              Chromosome:
              15:43691047
              Gene:
              CKMT1A (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              no info
              HGVS:
              NC_000015.10:g.43691047C>A, NC_000015.9:g.43983245C>A, NM_001015001.2:c.-2231C>A, NM_001321927.1:c.-2231C>A, XM_005254193.1:c.-49+18737G>T, XM_017022369.1:c.-2168C>A, XM_017022370.1:c.-2093C>A, XM_017022371.1:c.-2231C>A
              11.
              13.
              15.

              rs796724522 [Homo sapiens]
                ACCCCCAGGTTTCGGCTCACCCCGG[A/G]ACCCGGCCCTAGCCCCTACCCACAG
                Chromosome:
                15:43648798
                Gene:
                CATSPER2 (GeneView)
                Functional Consequence:
                intron variant,upstream variant 2KB,utr variant 5 prime
                Validated:
                no info
                HGVS:
                NC_000015.10:g.43648798G>A, NC_000015.9:g.43940996G>A, NG_009283.1:g.5044C>T, NM_001282309.1:c.-87+20C>T, NM_001282310.1:c.13+24C>T, NM_054020.3:c.-172C>T, NM_172095.2:c.-172C>T, NM_172097.1:c.-172C>T, NR_110319.1:n.-735C>T, XM_005254193.1:c.-48-30028C>T, XM_017021904.1:c.-175C>T
                17.

                rs796661934 [Homo sapiens]
                  AACTCTGTCTCAAAAAAAAAAAAAA[A/G]AAGAAAAAGAAAAAAGTAAGAATGA
                  Chromosome:
                  15:43706489
                  Validated:
                  no info
                  HGVS:
                  NC_000015.10:g.43706489A>G, NC_000015.9:g.43998687A>G, NG_029359.1:g.11874T>C, XM_005254193.1:c.-49+3295T>C
                  18.

                  rs796655833 [Homo sapiens]
                    CAAAAACCTAATTAAGGCCAATTGT[A/G]GTGGCTCGCGCCTACAATCCCAGTA
                    Chromosome:
                    15:43691066
                    Gene:
                    CKMT1A (GeneView)
                    Functional Consequence:
                    upstream variant 2KB
                    Validated:
                    no info
                    HGVS:
                    NC_000015.10:g.43691066A>G, NC_000015.9:g.43983264A>G, NM_001015001.2:c.-2212A>G, NM_001321927.1:c.-2212A>G, XM_005254193.1:c.-49+18718T>C, XM_017022369.1:c.-2149A>G, XM_017022370.1:c.-2074A>G, XM_017022371.1:c.-2212A>G
                    19.

                    rs796598517 [Homo sapiens]
                      GCTTTTGAATCTTTTTTTTTTTTTT[-/TT]GCAAACTCTGCCACCCAGATTCAAG
                      Chromosome:
                      15:43625997
                      Validated:
                      no info
                      HGVS:
                      NC_000015.10:g.43625997_43625998delTT, NC_000015.9:g.43918195_43918196delTT, XM_005254193.1:c.-48-7228_-48-7227delAA
                      20.

                      rs796580014 [Homo sapiens]
                        TCTGCAGCTGGGCACGATGGCTCAC[A/G]CCTGTAATCCTAACACTTTTGGAGG
                        Chromosome:
                        15:43633682
                        Gene:
                        CATSPER2 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        NC_000015.10:g.43633682A>G, NC_000015.9:g.43925880A>G, NG_009283.1:g.20160T>C, NM_001282309.1:c.1179-754T>C, NM_001282310.1:c.1197-754T>C, NM_054020.3:c.1179-754T>C, NM_172095.2:c.1179-748T>C, NR_110319.1:n.1181-1319T>C, XM_005254193.1:c.-48-14912T>C, XM_017021904.1:c.1179-748T>C

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center