Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs760580125

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chrX:67546515-67546516 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
insAGG / insAGGCGG / insGGG / insG…

insAGG / insAGGCGG / insGGG / insGGGCGGTGGCGG / insGGGTGGCGG / insGGG(TGG)2CGG / insGGG(TGG)2(CGG)2 / insTGGCGG / insT(GGC)2GG / insT(GGC)3GG / insT(GGC)4GG / insT(GGC)5GG / insT(GGC)6GG / insT(G)5 / insT(G)5(TGG)2CGG / insT(G)5(TGG)2(CGG)2 / ins(TGG)2(CGG)2 / ins(TGG)2G(GGT)2(GGC)3GG / ins(TGG)2G(GGT)3(GGC)3GG

Variation Type
Indel Insertion and Deletion
Frequency
insGGG(TGG)2(CGG)2=0.000004 (1/264690, TOPMED)
insT(GGC)3GG=0.00460 (68/14784, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
AR : Inframe Insertion
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insAGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insAGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insGGG
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516G[5]CGGTGGCGG[1]
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516G[5]TGGCGG[1]
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516G[5]TGG[2]CGG[1]
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516G[5]TGG[2]CGG[2]
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGCGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGCGGCGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGCGGCGGCGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGCGGCGGCGGCGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGCGGCGGCGGCGGCGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGGGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGGGGTGGTGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546516_67546517insTGGGGGTGGTGGCGGCGG
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516GGT[2]GGC[2]GG[1]
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516GGT[2]G[5]TGG[2]CGG[3]
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516GGT[2]G[5]TGG[3]CGG[3]
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insAGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insAGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insGGG
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358G[5]CGGTGGCGG[1]
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358G[5]TGGCGG[1]
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358G[5]TGG[2]CGG[1]
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358G[5]TGG[2]CGG[2]
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGCGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGCGGCGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGCGGCGGCGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGCGGCGGCGGCGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGCGGCGGCGGCGGCGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGGGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGGGGTGGTGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766358_66766359insTGGGGGTGGTGGCGGCGG
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358GGT[2]GGC[2]GG[1]
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358GGT[2]G[5]TGG[2]CGG[3]
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358GGT[2]G[5]TGG[3]CGG[3]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insAGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insAGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insGGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485G[5]CGGTGGCGG[1]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485G[5]TGGCGG[1]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485G[5]TGG[2]CGG[1]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485G[5]TGG[2]CGG[2]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGCGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGCGGCGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGCGGCGGCGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGCGGCGGCGGCGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGCGGCGGCGGCGGCGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGGGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGGGGTGGTGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7485_7486insTGGGGGTGGTGGCGGCGG
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485GGT[2]GGC[2]GG[1]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485GGT[2]G[5]TGG[2]CGG[3]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485GGT[2]G[5]TGG[3]CGG[3]
Gene: AR, androgen receptor (plus strand)
Molecule type Change Amino acid[Codon] SO Term
AR transcript variant 2 NM_001011645.3:c.-415_-41…

NM_001011645.3:c.-415_-414=

N/A 5 Prime UTR Variant
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insAGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGAGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insAGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGAGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly472_G…

NP_001334990.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGGGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insGGGCGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGCGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly470_G…

NP_001334990.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insGGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly471_G…

NP_001334990.1:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly470_G…

NP_001334990.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly469_G…

NP_001334990.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly472_G…

NP_001334990.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly471_G…

NP_001334990.1:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly470_G…

NP_001334990.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly469_G…

NP_001334990.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly468_G…

NP_001334990.1:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly467_G…

NP_001334990.1:p.Gly467_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly472_G…

NP_001334990.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly469_G…

NP_001334990.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly468_G…

NP_001334990.1:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly470_G…

NP_001334990.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly466_G…

NP_001334990.1:p.Gly466_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.1370_137…

NM_001348061.1:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gly465_G…

NP_001334990.1:p.Gly465_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insAGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGAGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insAGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGAGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly472_G…

NP_001334992.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGGGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insGGGCGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGCGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly470_G…

NP_001334992.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insGGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly471_G…

NP_001334992.1:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly470_G…

NP_001334992.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly469_G…

NP_001334992.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly472_G…

NP_001334992.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly471_G…

NP_001334992.1:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly470_G…

NP_001334992.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly469_G…

NP_001334992.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly468_G…

NP_001334992.1:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly467_G…

NP_001334992.1:p.Gly467_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly472_G…

NP_001334992.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly469_G…

NP_001334992.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly468_G…

NP_001334992.1:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly470_G…

NP_001334992.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly466_G…

NP_001334992.1:p.Gly466_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.1370_137…

NM_001348063.1:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gly465_G…

NP_001334992.1:p.Gly465_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insAGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGAGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insAGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGAGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly472_G…

NP_001334993.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGGGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insGGGCGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGCGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly470_G…

NP_001334993.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insGGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly471_G…

NP_001334993.1:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly470_G…

NP_001334993.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly469_G…

NP_001334993.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly472_G…

NP_001334993.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly471_G…

NP_001334993.1:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly470_G…

NP_001334993.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly469_G…

NP_001334993.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly468_G…

NP_001334993.1:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly467_G…

NP_001334993.1:p.Gly467_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly472_G…

NP_001334993.1:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly469_G…

NP_001334993.1:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly468_G…

NP_001334993.1:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly470_G…

NP_001334993.1:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly466_G…

NP_001334993.1:p.Gly466_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.1370_137…

NM_001348064.1:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gly465_G…

NP_001334993.1:p.Gly465_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insAGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGAGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insAGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGAGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly472_Gly4…

NP_000035.2:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGG [GGGGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly473dup GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insGGGCGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGCGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly470_Gly4…

NP_000035.2:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insGGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly471_Gly4…

NP_000035.2:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly470_Gly4…

NP_000035.2:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly469_Gly4…

NP_000035.2:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly472_Gly4…

NP_000035.2:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly471_Gly4…

NP_000035.2:p.Gly471_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly470_Gly4…

NP_000035.2:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly469_Gly4…

NP_000035.2:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly468_Gly4…

NP_000035.2:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGCGGCGGCGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly467_Gly4…

NP_000035.2:p.Gly467_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGGGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly472_Gly4…

NP_000035.2:p.Gly472_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGGGGTGGTGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly469_Gly4…

NP_000035.2:p.Gly469_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGGGGTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGGGGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly468_Gly4…

NP_000035.2:p.Gly468_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGTGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly470_Gly4…

NP_000035.2:p.Gly470_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly466_Gly4…

NP_000035.2:p.Gly466_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.1370_1371in…

NM_000044.6:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG

GGGGGGGGGGGGGGGGGGGGGGG [G...

GGGGGGGGGGGGGGGGGGGGGGG [GGC] > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG [GGTGGTGGGGGTGGTGGTGGCGGCGGCGGC]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gly465_Gly4…

NP_000035.2:p.Gly465_Gly473dup

GGGGGGGGGGGGGGGGGGGGGGG (…

GGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly) > GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG (GlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGly)

Inframe Insertion
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 14784 GG=0.99540 GGAGG=0.00000, GGAGGCGG=0.00000, GGGGG=0.00000, GGGGGCGGTGGCGG=0.00000, GGGGGTGGCGG=0.00000, GGGGGTGGTGGCGG=0.00000, GGGGGTGGTGGCGGCGG=0.00000, GGTGGCGG=0.00000, GGTGGCGGCGG=0.00000, GGTGGCGGCGGCGG=0.00460, GGTGGCGGCGGCGGCGG=0.00000, GGTGGCGGCGGCGGCGGCGG=0.00000, GGTGGCGGCGGCGGCGGCGGCGG=0.00000, GGTGGGGG=0.00000, GGTGGGGGTGGTGGCGG=0.00000, GGTGGGGGTGGTGGCGGCGG=0.00000, GGTGGTGGCGGCGG=0.00000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.00000
European Sub 10536 GG=0.99355 GGAGG=0.00000, GGAGGCGG=0.00000, GGGGG=0.00000, GGGGGCGGTGGCGG=0.00000, GGGGGTGGCGG=0.00000, GGGGGTGGTGGCGG=0.00000, GGGGGTGGTGGCGGCGG=0.00000, GGTGGCGG=0.00000, GGTGGCGGCGG=0.00000, GGTGGCGGCGGCGG=0.00645, GGTGGCGGCGGCGGCGG=0.00000, GGTGGCGGCGGCGGCGGCGG=0.00000, GGTGGCGGCGGCGGCGGCGGCGG=0.00000, GGTGGGGG=0.00000, GGTGGGGGTGGTGGCGG=0.00000, GGTGGGGGTGGTGGCGGCGG=0.00000, GGTGGTGGCGGCGG=0.00000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.00000
African Sub 2816 GG=1.0000 GGAGG=0.0000, GGAGGCGG=0.0000, GGGGG=0.0000, GGGGGCGGTGGCGG=0.0000, GGGGGTGGCGG=0.0000, GGGGGTGGTGGCGG=0.0000, GGGGGTGGTGGCGGCGG=0.0000, GGTGGCGG=0.0000, GGTGGCGGCGG=0.0000, GGTGGCGGCGGCGG=0.0000, GGTGGCGGCGGCGGCGG=0.0000, GGTGGCGGCGGCGGCGGCGG=0.0000, GGTGGCGGCGGCGGCGGCGGCGG=0.0000, GGTGGGGG=0.0000, GGTGGGGGTGGTGGCGG=0.0000, GGTGGGGGTGGTGGCGGCGG=0.0000, GGTGGTGGCGGCGG=0.0000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.0000
African Others Sub 108 GG=1.000 GGAGG=0.000, GGAGGCGG=0.000, GGGGG=0.000, GGGGGCGGTGGCGG=0.000, GGGGGTGGCGG=0.000, GGGGGTGGTGGCGG=0.000, GGGGGTGGTGGCGGCGG=0.000, GGTGGCGG=0.000, GGTGGCGGCGG=0.000, GGTGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGGCGG=0.000, GGTGGGGG=0.000, GGTGGGGGTGGTGGCGG=0.000, GGTGGGGGTGGTGGCGGCGG=0.000, GGTGGTGGCGGCGG=0.000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.000
African American Sub 2708 GG=1.0000 GGAGG=0.0000, GGAGGCGG=0.0000, GGGGG=0.0000, GGGGGCGGTGGCGG=0.0000, GGGGGTGGCGG=0.0000, GGGGGTGGTGGCGG=0.0000, GGGGGTGGTGGCGGCGG=0.0000, GGTGGCGG=0.0000, GGTGGCGGCGG=0.0000, GGTGGCGGCGGCGG=0.0000, GGTGGCGGCGGCGGCGG=0.0000, GGTGGCGGCGGCGGCGGCGG=0.0000, GGTGGCGGCGGCGGCGGCGGCGG=0.0000, GGTGGGGG=0.0000, GGTGGGGGTGGTGGCGG=0.0000, GGTGGGGGTGGTGGCGGCGG=0.0000, GGTGGTGGCGGCGG=0.0000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.0000
Asian Sub 108 GG=1.000 GGAGG=0.000, GGAGGCGG=0.000, GGGGG=0.000, GGGGGCGGTGGCGG=0.000, GGGGGTGGCGG=0.000, GGGGGTGGTGGCGG=0.000, GGGGGTGGTGGCGGCGG=0.000, GGTGGCGG=0.000, GGTGGCGGCGG=0.000, GGTGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGGCGG=0.000, GGTGGGGG=0.000, GGTGGGGGTGGTGGCGG=0.000, GGTGGGGGTGGTGGCGGCGG=0.000, GGTGGTGGCGGCGG=0.000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.000
East Asian Sub 84 GG=1.00 GGAGG=0.00, GGAGGCGG=0.00, GGGGG=0.00, GGGGGCGGTGGCGG=0.00, GGGGGTGGCGG=0.00, GGGGGTGGTGGCGG=0.00, GGGGGTGGTGGCGGCGG=0.00, GGTGGCGG=0.00, GGTGGCGGCGG=0.00, GGTGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGGCGGCGG=0.00, GGTGGGGG=0.00, GGTGGGGGTGGTGGCGG=0.00, GGTGGGGGTGGTGGCGGCGG=0.00, GGTGGTGGCGGCGG=0.00, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.00
Other Asian Sub 24 GG=1.00 GGAGG=0.00, GGAGGCGG=0.00, GGGGG=0.00, GGGGGCGGTGGCGG=0.00, GGGGGTGGCGG=0.00, GGGGGTGGTGGCGG=0.00, GGGGGTGGTGGCGGCGG=0.00, GGTGGCGG=0.00, GGTGGCGGCGG=0.00, GGTGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGGCGGCGG=0.00, GGTGGGGG=0.00, GGTGGGGGTGGTGGCGG=0.00, GGTGGGGGTGGTGGCGGCGG=0.00, GGTGGTGGCGGCGG=0.00, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.00
Latin American 1 Sub 146 GG=1.000 GGAGG=0.000, GGAGGCGG=0.000, GGGGG=0.000, GGGGGCGGTGGCGG=0.000, GGGGGTGGCGG=0.000, GGGGGTGGTGGCGG=0.000, GGGGGTGGTGGCGGCGG=0.000, GGTGGCGG=0.000, GGTGGCGGCGG=0.000, GGTGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGGCGG=0.000, GGTGGGGG=0.000, GGTGGGGGTGGTGGCGG=0.000, GGTGGGGGTGGTGGCGGCGG=0.000, GGTGGTGGCGGCGG=0.000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.000
Latin American 2 Sub 610 GG=1.000 GGAGG=0.000, GGAGGCGG=0.000, GGGGG=0.000, GGGGGCGGTGGCGG=0.000, GGGGGTGGCGG=0.000, GGGGGTGGTGGCGG=0.000, GGGGGTGGTGGCGGCGG=0.000, GGTGGCGG=0.000, GGTGGCGGCGG=0.000, GGTGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGGCGG=0.000, GGTGGGGG=0.000, GGTGGGGGTGGTGGCGG=0.000, GGTGGGGGTGGTGGCGGCGG=0.000, GGTGGTGGCGGCGG=0.000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.000
South Asian Sub 94 GG=1.00 GGAGG=0.00, GGAGGCGG=0.00, GGGGG=0.00, GGGGGCGGTGGCGG=0.00, GGGGGTGGCGG=0.00, GGGGGTGGTGGCGG=0.00, GGGGGTGGTGGCGGCGG=0.00, GGTGGCGG=0.00, GGTGGCGGCGG=0.00, GGTGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGGCGG=0.00, GGTGGCGGCGGCGGCGGCGGCGG=0.00, GGTGGGGG=0.00, GGTGGGGGTGGTGGCGG=0.00, GGTGGGGGTGGTGGCGGCGG=0.00, GGTGGTGGCGGCGG=0.00, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.00
Other Sub 474 GG=1.000 GGAGG=0.000, GGAGGCGG=0.000, GGGGG=0.000, GGGGGCGGTGGCGG=0.000, GGGGGTGGCGG=0.000, GGGGGTGGTGGCGG=0.000, GGGGGTGGTGGCGGCGG=0.000, GGTGGCGG=0.000, GGTGGCGGCGG=0.000, GGTGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGG=0.000, GGTGGCGGCGGCGGCGGCGGCGG=0.000, GGTGGGGG=0.000, GGTGGGGGTGGTGGCGG=0.000, GGTGGGGGTGGTGGCGGCGG=0.000, GGTGGTGGCGGCGG=0.000, GGTGGTGGGGGTGGTGGTGGCGGCGGCGG=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 -

No frequency provided

insGGG(TGG)2(CGG)2=0.000004
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement GG= insAGG insAGGCGG insGGG insGGGCGGTGGCGG insGGGTGGCGG insGGG(TGG)2CGG insGGG(TGG)2(CGG)2 insTGGCGG insT(GGC)2GG insT(GGC)3GG insT(GGC)4GG insT(GGC)5GG insT(GGC)6GG insT(G)5 insT(G)5(TGG)2CGG insT(G)5(TGG)2(CGG)2 ins(TGG)2(CGG)2 ins(TGG)2G(GGT)2(GGC)3GG ins(TGG)2G(GGT)3(GGC)3GG
GRCh38.p13 chr X NC_000023.11:g.67546515_67546516= NC_000023.11:g.67546516_67546517insAGG NC_000023.11:g.67546516_67546517insAGGCGG NC_000023.11:g.67546516_67546517insGGG NC_000023.11:g.67546515_67546516G[5]CGGTGGCGG[1] NC_000023.11:g.67546515_67546516G[5]TGGCGG[1] NC_000023.11:g.67546515_67546516G[5]TGG[2]CGG[1] NC_000023.11:g.67546515_67546516G[5]TGG[2]CGG[2] NC_000023.11:g.67546516_67546517insTGGCGG NC_000023.11:g.67546516_67546517insTGGCGGCGG NC_000023.11:g.67546516_67546517insTGGCGGCGGCGG NC_000023.11:g.67546516_67546517insTGGCGGCGGCGGCGG NC_000023.11:g.67546516_67546517insTGGCGGCGGCGGCGGCGG NC_000023.11:g.67546516_67546517insTGGCGGCGGCGGCGGCGGCGG NC_000023.11:g.67546516_67546517insTGGGGG NC_000023.11:g.67546516_67546517insTGGGGGTGGTGGCGG NC_000023.11:g.67546516_67546517insTGGGGGTGGTGGCGGCGG NC_000023.11:g.67546515_67546516GGT[2]GGC[2]GG[1] NC_000023.11:g.67546515_67546516GGT[2]G[5]TGG[2]CGG[3] NC_000023.11:g.67546515_67546516GGT[2]G[5]TGG[3]CGG[3]
GRCh37.p13 chr X NC_000023.10:g.66766357_66766358= NC_000023.10:g.66766358_66766359insAGG NC_000023.10:g.66766358_66766359insAGGCGG NC_000023.10:g.66766358_66766359insGGG NC_000023.10:g.66766357_66766358G[5]CGGTGGCGG[1] NC_000023.10:g.66766357_66766358G[5]TGGCGG[1] NC_000023.10:g.66766357_66766358G[5]TGG[2]CGG[1] NC_000023.10:g.66766357_66766358G[5]TGG[2]CGG[2] NC_000023.10:g.66766358_66766359insTGGCGG NC_000023.10:g.66766358_66766359insTGGCGGCGG NC_000023.10:g.66766358_66766359insTGGCGGCGGCGG NC_000023.10:g.66766358_66766359insTGGCGGCGGCGGCGG NC_000023.10:g.66766358_66766359insTGGCGGCGGCGGCGGCGG NC_000023.10:g.66766358_66766359insTGGCGGCGGCGGCGGCGGCGG NC_000023.10:g.66766358_66766359insTGGGGG NC_000023.10:g.66766358_66766359insTGGGGGTGGTGGCGG NC_000023.10:g.66766358_66766359insTGGGGGTGGTGGCGGCGG NC_000023.10:g.66766357_66766358GGT[2]GGC[2]GG[1] NC_000023.10:g.66766357_66766358GGT[2]G[5]TGG[2]CGG[3] NC_000023.10:g.66766357_66766358GGT[2]G[5]TGG[3]CGG[3]
AR RefSeqGene (LRG_1406) NG_009014.2:g.7484_7485= NG_009014.2:g.7485_7486insAGG NG_009014.2:g.7485_7486insAGGCGG NG_009014.2:g.7485_7486insGGG NG_009014.2:g.7484_7485G[5]CGGTGGCGG[1] NG_009014.2:g.7484_7485G[5]TGGCGG[1] NG_009014.2:g.7484_7485G[5]TGG[2]CGG[1] NG_009014.2:g.7484_7485G[5]TGG[2]CGG[2] NG_009014.2:g.7485_7486insTGGCGG NG_009014.2:g.7485_7486insTGGCGGCGG NG_009014.2:g.7485_7486insTGGCGGCGGCGG NG_009014.2:g.7485_7486insTGGCGGCGGCGGCGG NG_009014.2:g.7485_7486insTGGCGGCGGCGGCGGCGG NG_009014.2:g.7485_7486insTGGCGGCGGCGGCGGCGGCGG NG_009014.2:g.7485_7486insTGGGGG NG_009014.2:g.7485_7486insTGGGGGTGGTGGCGG NG_009014.2:g.7485_7486insTGGGGGTGGTGGCGGCGG NG_009014.2:g.7484_7485GGT[2]GGC[2]GG[1] NG_009014.2:g.7484_7485GGT[2]G[5]TGG[2]CGG[3] NG_009014.2:g.7484_7485GGT[2]G[5]TGG[3]CGG[3]
AR transcript variant 1 NM_000044.6:c.1369_1370= NM_000044.6:c.1370_1371insAGG NM_000044.6:c.1370_1371insAGGCGG NM_000044.6:c.1370_1371insGGG NM_000044.6:c.1370_1371insGGGCGGTGGCGG NM_000044.6:c.1370_1371insGGGTGGCGG NM_000044.6:c.1370_1371insGGGTGGTGGCGG NM_000044.6:c.1370_1371insGGGTGGTGGCGGCGG NM_000044.6:c.1370_1371insTGGCGG NM_000044.6:c.1370_1371insTGGCGGCGG NM_000044.6:c.1370_1371insTGGCGGCGGCGG NM_000044.6:c.1370_1371insTGGCGGCGGCGGCGG NM_000044.6:c.1370_1371insTGGCGGCGGCGGCGGCGG NM_000044.6:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG NM_000044.6:c.1370_1371insTGGGGG NM_000044.6:c.1370_1371insTGGGGGTGGTGGCGG NM_000044.6:c.1370_1371insTGGGGGTGGTGGCGGCGG NM_000044.6:c.1370_1371insTGGTGGCGGCGG NM_000044.6:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG NM_000044.6:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG
AR transcript variant 1 NM_000044.5:c.1369_1370= NM_000044.5:c.1370_1371insAGG NM_000044.5:c.1370_1371insAGGCGG NM_000044.5:c.1370_1371insGGG NM_000044.5:c.1370_1371insGGGCGGTGGCGG NM_000044.5:c.1370_1371insGGGTGGCGG NM_000044.5:c.1370_1371insGGGTGGTGGCGG NM_000044.5:c.1370_1371insGGGTGGTGGCGGCGG NM_000044.5:c.1370_1371insTGGCGG NM_000044.5:c.1370_1371insTGGCGGCGG NM_000044.5:c.1370_1371insTGGCGGCGGCGG NM_000044.5:c.1370_1371insTGGCGGCGGCGGCGG NM_000044.5:c.1370_1371insTGGCGGCGGCGGCGGCGG NM_000044.5:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG NM_000044.5:c.1370_1371insTGGGGG NM_000044.5:c.1370_1371insTGGGGGTGGTGGCGG NM_000044.5:c.1370_1371insTGGGGGTGGTGGCGGCGG NM_000044.5:c.1370_1371insTGGTGGCGGCGG NM_000044.5:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG NM_000044.5:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG
AR transcript variant 1 NM_000044.4:c.1369_1370= NM_000044.4:c.1370_1371insAGG NM_000044.4:c.1370_1371insAGGCGG NM_000044.4:c.1370_1371insGGG NM_000044.4:c.1370_1371insGGGCGGTGGCGG NM_000044.4:c.1370_1371insGGGTGGCGG NM_000044.4:c.1370_1371insGGGTGGTGGCGG NM_000044.4:c.1370_1371insGGGTGGTGGCGGCGG NM_000044.4:c.1370_1371insTGGCGG NM_000044.4:c.1370_1371insTGGCGGCGG NM_000044.4:c.1370_1371insTGGCGGCGGCGG NM_000044.4:c.1370_1371insTGGCGGCGGCGGCGG NM_000044.4:c.1370_1371insTGGCGGCGGCGGCGGCGG NM_000044.4:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG NM_000044.4:c.1370_1371insTGGGGG NM_000044.4:c.1370_1371insTGGGGGTGGTGGCGG NM_000044.4:c.1370_1371insTGGGGGTGGTGGCGGCGG NM_000044.4:c.1370_1371insTGGTGGCGGCGG NM_000044.4:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG NM_000044.4:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG
AR transcript variant 1 NM_000044.3:c.1369_1370= NM_000044.3:c.1370_1371insAGG NM_000044.3:c.1370_1371insAGGCGG NM_000044.3:c.1370_1371insGGG NM_000044.3:c.1370_1371insGGGCGGTGGCGG NM_000044.3:c.1370_1371insGGGTGGCGG NM_000044.3:c.1370_1371insGGGTGGTGGCGG NM_000044.3:c.1370_1371insGGGTGGTGGCGGCGG NM_000044.3:c.1370_1371insTGGCGG NM_000044.3:c.1370_1371insTGGCGGCGG NM_000044.3:c.1370_1371insTGGCGGCGGCGG NM_000044.3:c.1370_1371insTGGCGGCGGCGGCGG NM_000044.3:c.1370_1371insTGGCGGCGGCGGCGGCGG NM_000044.3:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG NM_000044.3:c.1370_1371insTGGGGG NM_000044.3:c.1370_1371insTGGGGGTGGTGGCGG NM_000044.3:c.1370_1371insTGGGGGTGGTGGCGGCGG NM_000044.3:c.1370_1371insTGGTGGCGGCGG NM_000044.3:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG NM_000044.3:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG
AR transcript variant 2 NM_001011645.3:c.-415_-414= NM_001011645.3:c.-414_-413insAGG NM_001011645.3:c.-414_-413insAGGCGG NM_001011645.3:c.-414_-413insGGG NM_001011645.3:c.-415_-414G[5]CGGTGGCGG[1] NM_001011645.3:c.-415_-414G[5]TGGCGG[1] NM_001011645.3:c.-415_-414G[5]TGG[2]CGG[1] NM_001011645.3:c.-415_-414G[5]TGG[2]CGG[2] NM_001011645.3:c.-414_-413insTGGCGG NM_001011645.3:c.-414_-413insTGGCGGCGG NM_001011645.3:c.-414_-413insTGGCGGCGGCGG NM_001011645.3:c.-414_-413insTGGCGGCGGCGGCGG NM_001011645.3:c.-414_-413insTGGCGGCGGCGGCGGCGG NM_001011645.3:c.-414_-413insTGGCGGCGGCGGCGGCGGCGG NM_001011645.3:c.-414_-413insTGGGGG NM_001011645.3:c.-414_-413insTGGGGGTGGTGGCGG NM_001011645.3:c.-414_-413insTGGGGGTGGTGGCGGCGG NM_001011645.3:c.-415_-414GGT[2]GGC[2]GG[1] NM_001011645.3:c.-415_-414GGT[2]G[5]TGG[2]CGG[3] NM_001011645.3:c.-415_-414GGT[2]G[5]TGG[3]CGG[3]
AR transcript variant 3 NM_001348061.1:c.1369_1370= NM_001348061.1:c.1370_1371insAGG NM_001348061.1:c.1370_1371insAGGCGG NM_001348061.1:c.1370_1371insGGG NM_001348061.1:c.1370_1371insGGGCGGTGGCGG NM_001348061.1:c.1370_1371insGGGTGGCGG NM_001348061.1:c.1370_1371insGGGTGGTGGCGG NM_001348061.1:c.1370_1371insGGGTGGTGGCGGCGG NM_001348061.1:c.1370_1371insTGGCGG NM_001348061.1:c.1370_1371insTGGCGGCGG NM_001348061.1:c.1370_1371insTGGCGGCGGCGG NM_001348061.1:c.1370_1371insTGGCGGCGGCGGCGG NM_001348061.1:c.1370_1371insTGGCGGCGGCGGCGGCGG NM_001348061.1:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG NM_001348061.1:c.1370_1371insTGGGGG NM_001348061.1:c.1370_1371insTGGGGGTGGTGGCGG NM_001348061.1:c.1370_1371insTGGGGGTGGTGGCGGCGG NM_001348061.1:c.1370_1371insTGGTGGCGGCGG NM_001348061.1:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG NM_001348061.1:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG
AR transcript variant 5 NM_001348064.1:c.1369_1370= NM_001348064.1:c.1370_1371insAGG NM_001348064.1:c.1370_1371insAGGCGG NM_001348064.1:c.1370_1371insGGG NM_001348064.1:c.1370_1371insGGGCGGTGGCGG NM_001348064.1:c.1370_1371insGGGTGGCGG NM_001348064.1:c.1370_1371insGGGTGGTGGCGG NM_001348064.1:c.1370_1371insGGGTGGTGGCGGCGG NM_001348064.1:c.1370_1371insTGGCGG NM_001348064.1:c.1370_1371insTGGCGGCGG NM_001348064.1:c.1370_1371insTGGCGGCGGCGG NM_001348064.1:c.1370_1371insTGGCGGCGGCGGCGG NM_001348064.1:c.1370_1371insTGGCGGCGGCGGCGGCGG NM_001348064.1:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG NM_001348064.1:c.1370_1371insTGGGGG NM_001348064.1:c.1370_1371insTGGGGGTGGTGGCGG NM_001348064.1:c.1370_1371insTGGGGGTGGTGGCGGCGG NM_001348064.1:c.1370_1371insTGGTGGCGGCGG NM_001348064.1:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG NM_001348064.1:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG
AR transcript variant 4 NM_001348063.1:c.1369_1370= NM_001348063.1:c.1370_1371insAGG NM_001348063.1:c.1370_1371insAGGCGG NM_001348063.1:c.1370_1371insGGG NM_001348063.1:c.1370_1371insGGGCGGTGGCGG NM_001348063.1:c.1370_1371insGGGTGGCGG NM_001348063.1:c.1370_1371insGGGTGGTGGCGG NM_001348063.1:c.1370_1371insGGGTGGTGGCGGCGG NM_001348063.1:c.1370_1371insTGGCGG NM_001348063.1:c.1370_1371insTGGCGGCGG NM_001348063.1:c.1370_1371insTGGCGGCGGCGG NM_001348063.1:c.1370_1371insTGGCGGCGGCGGCGG NM_001348063.1:c.1370_1371insTGGCGGCGGCGGCGGCGG NM_001348063.1:c.1370_1371insTGGCGGCGGCGGCGGCGGCGG NM_001348063.1:c.1370_1371insTGGGGG NM_001348063.1:c.1370_1371insTGGGGGTGGTGGCGG NM_001348063.1:c.1370_1371insTGGGGGTGGTGGCGGCGG NM_001348063.1:c.1370_1371insTGGTGGCGGCGG NM_001348063.1:c.1370_1371insTGGTGGGGGTGGTGGCGGCGGCGG NM_001348063.1:c.1370_1371insTGGTGGGGGTGGTGGTGGCGGCGGCGG
androgen receptor isoform 1 NP_000035.2:p.Gly457= NP_000035.2:p.Gly473dup NP_000035.2:p.Gly472_Gly473dup NP_000035.2:p.Gly473dup NP_000035.2:p.Gly470_Gly473dup NP_000035.2:p.Gly471_Gly473dup NP_000035.2:p.Gly470_Gly473dup NP_000035.2:p.Gly469_Gly473dup NP_000035.2:p.Gly472_Gly473dup NP_000035.2:p.Gly471_Gly473dup NP_000035.2:p.Gly470_Gly473dup NP_000035.2:p.Gly469_Gly473dup NP_000035.2:p.Gly468_Gly473dup NP_000035.2:p.Gly467_Gly473dup NP_000035.2:p.Gly472_Gly473dup NP_000035.2:p.Gly469_Gly473dup NP_000035.2:p.Gly468_Gly473dup NP_000035.2:p.Gly470_Gly473dup NP_000035.2:p.Gly466_Gly473dup NP_000035.2:p.Gly465_Gly473dup
androgen receptor isoform 3 NP_001334990.1:p.Gly457= NP_001334990.1:p.Gly473dup NP_001334990.1:p.Gly472_Gly473dup NP_001334990.1:p.Gly473dup NP_001334990.1:p.Gly470_Gly473dup NP_001334990.1:p.Gly471_Gly473dup NP_001334990.1:p.Gly470_Gly473dup NP_001334990.1:p.Gly469_Gly473dup NP_001334990.1:p.Gly472_Gly473dup NP_001334990.1:p.Gly471_Gly473dup NP_001334990.1:p.Gly470_Gly473dup NP_001334990.1:p.Gly469_Gly473dup NP_001334990.1:p.Gly468_Gly473dup NP_001334990.1:p.Gly467_Gly473dup NP_001334990.1:p.Gly472_Gly473dup NP_001334990.1:p.Gly469_Gly473dup NP_001334990.1:p.Gly468_Gly473dup NP_001334990.1:p.Gly470_Gly473dup NP_001334990.1:p.Gly466_Gly473dup NP_001334990.1:p.Gly465_Gly473dup
androgen receptor isoform 5 NP_001334993.1:p.Gly457= NP_001334993.1:p.Gly473dup NP_001334993.1:p.Gly472_Gly473dup NP_001334993.1:p.Gly473dup NP_001334993.1:p.Gly470_Gly473dup NP_001334993.1:p.Gly471_Gly473dup NP_001334993.1:p.Gly470_Gly473dup NP_001334993.1:p.Gly469_Gly473dup NP_001334993.1:p.Gly472_Gly473dup NP_001334993.1:p.Gly471_Gly473dup NP_001334993.1:p.Gly470_Gly473dup NP_001334993.1:p.Gly469_Gly473dup NP_001334993.1:p.Gly468_Gly473dup NP_001334993.1:p.Gly467_Gly473dup NP_001334993.1:p.Gly472_Gly473dup NP_001334993.1:p.Gly469_Gly473dup NP_001334993.1:p.Gly468_Gly473dup NP_001334993.1:p.Gly470_Gly473dup NP_001334993.1:p.Gly466_Gly473dup NP_001334993.1:p.Gly465_Gly473dup
androgen receptor isoform 4 NP_001334992.1:p.Gly457= NP_001334992.1:p.Gly473dup NP_001334992.1:p.Gly472_Gly473dup NP_001334992.1:p.Gly473dup NP_001334992.1:p.Gly470_Gly473dup NP_001334992.1:p.Gly471_Gly473dup NP_001334992.1:p.Gly470_Gly473dup NP_001334992.1:p.Gly469_Gly473dup NP_001334992.1:p.Gly472_Gly473dup NP_001334992.1:p.Gly471_Gly473dup NP_001334992.1:p.Gly470_Gly473dup NP_001334992.1:p.Gly469_Gly473dup NP_001334992.1:p.Gly468_Gly473dup NP_001334992.1:p.Gly467_Gly473dup NP_001334992.1:p.Gly472_Gly473dup NP_001334992.1:p.Gly469_Gly473dup NP_001334992.1:p.Gly468_Gly473dup NP_001334992.1:p.Gly470_Gly473dup NP_001334992.1:p.Gly466_Gly473dup NP_001334992.1:p.Gly465_Gly473dup
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

19 SubSNP, 14 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOPMED ss3613064343 Nov 08, 2017 (151)
2 TOPMED ss3613064353 Nov 08, 2017 (151)
3 TOPMED ss3613064354 Nov 08, 2017 (151)
4 TOPMED ss3613064355 Nov 08, 2017 (151)
5 TOPMED ss3613064356 Nov 08, 2017 (151)
6 TOPMED ss3613064357 Nov 08, 2017 (151)
7 GNOMAD ss4372947382 Apr 26, 2021 (155)
8 GNOMAD ss4372947402 Apr 26, 2021 (155)
9 GNOMAD ss4372947403 Apr 26, 2021 (155)
10 GNOMAD ss4372947404 Apr 26, 2021 (155)
11 GNOMAD ss4372947405 Apr 26, 2021 (155)
12 GNOMAD ss4372947406 Apr 26, 2021 (155)
13 GNOMAD ss4372947407 Apr 26, 2021 (155)
14 GNOMAD ss4372947408 Apr 26, 2021 (155)
15 GNOMAD ss4372947409 Apr 26, 2021 (155)
16 GNOMAD ss4372947410 Apr 26, 2021 (155)
17 GNOMAD ss4372947411 Apr 26, 2021 (155)
18 GNOMAD ss4372947412 Apr 26, 2021 (155)
19 TOPMED ss5125496007 Apr 26, 2021 (155)
20 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
21 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
22 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
23 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
24 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
25 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
26 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
27 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
28 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
29 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
30 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
31 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 582650927 (NC_000023.11:67546514::GGA 27/77853)
Row 582650947 (NC_000023.11:67546514::GGGGGTGGC 2/77853)
Row 582650948 (NC_000023.11:67546514::GGGGGTGGTGGC 9/77853)...

- Apr 26, 2021 (155)
32 TopMed NC_000023.11 - 67546515 Apr 26, 2021 (155)
33 ALFA NC_000023.11 - 67546515 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss3613064343, ss4372947382 NC_000023.11:67546514::GGA NC_000023.11:67546514:GG:GGAGG (self)
5349973643 NC_000023.11:67546514:GG:GGAGG NC_000023.11:67546514:GG:GGAGG
5349973643 NC_000023.11:67546514:GG:GGAGGCGG NC_000023.11:67546514:GG:GGAGGCGG
5349973643 NC_000023.11:67546514:GG:GGGGG NC_000023.11:67546514:GG:GGGGG
5349973643 NC_000023.11:67546514:GG:GGGGGCGGT…

NC_000023.11:67546514:GG:GGGGGCGGTGGCGG

NC_000023.11:67546514:GG:GGGGGCGGT…

NC_000023.11:67546514:GG:GGGGGCGGTGGCGG

ss4372947402 NC_000023.11:67546514::GGGGGTGGC NC_000023.11:67546514:GG:GGGGGTGGC…

NC_000023.11:67546514:GG:GGGGGTGGCGG

5349973643 NC_000023.11:67546514:GG:GGGGGTGGC…

NC_000023.11:67546514:GG:GGGGGTGGCGG

NC_000023.11:67546514:GG:GGGGGTGGC…

NC_000023.11:67546514:GG:GGGGGTGGCGG

ss4372947403 NC_000023.11:67546514::GGGGGTGGTGGC NC_000023.11:67546514:GG:GGGGGTGGT…

NC_000023.11:67546514:GG:GGGGGTGGTGGCGG

5349973643 NC_000023.11:67546514:GG:GGGGGTGGT…

NC_000023.11:67546514:GG:GGGGGTGGTGGCGG

NC_000023.11:67546514:GG:GGGGGTGGT…

NC_000023.11:67546514:GG:GGGGGTGGTGGCGG

689102364, ss5125496007 NC_000023.11:67546514::GGGGGTGGTGG…

NC_000023.11:67546514::GGGGGTGGTGGCGGC

NC_000023.11:67546514:GG:GGGGGTGGT…

NC_000023.11:67546514:GG:GGGGGTGGTGGCGGCGG

5349973643 NC_000023.11:67546514:GG:GGGGGTGGT…

NC_000023.11:67546514:GG:GGGGGTGGTGGCGGCGG

NC_000023.11:67546514:GG:GGGGGTGGT…

NC_000023.11:67546514:GG:GGGGGTGGTGGCGGCGG

ss3613064353, ss4372947404 NC_000023.11:67546514::GGTGGC NC_000023.11:67546514:GG:GGTGGCGG (self)
5349973643 NC_000023.11:67546514:GG:GGTGGCGG NC_000023.11:67546514:GG:GGTGGCGG
ss3613064354, ss4372947405 NC_000023.11:67546514::GGTGGCGGC NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGG

(self)
5349973643 NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGG

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGG

ss3613064355, ss4372947406 NC_000023.11:67546514::GGTGGCGGCGGC NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGG

(self)
5349973643 NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGG

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGG

ss3613064356, ss4372947407 NC_000023.11:67546514::GGTGGCGGCGG…

NC_000023.11:67546514::GGTGGCGGCGGCGGC

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGG

(self)
5349973643 NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGG

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGG

ss3613064357, ss4372947408 NC_000023.11:67546514::GGTGGCGGCGG…

NC_000023.11:67546514::GGTGGCGGCGGCGGCGGC

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGGCGG

(self)
5349973643 NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGGCGG

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGGCGG

ss4372947409 NC_000023.11:67546514::GGTGGCGGCGG…

NC_000023.11:67546514::GGTGGCGGCGGCGGCGGCGGC

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGGCGGCGG

5349973643 NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGGCGGCGG

NC_000023.11:67546514:GG:GGTGGCGGC…

NC_000023.11:67546514:GG:GGTGGCGGCGGCGGCGGCGGCGG

5349973643 NC_000023.11:67546514:GG:GGTGGGGG NC_000023.11:67546514:GG:GGTGGGGG
5349973643 NC_000023.11:67546514:GG:GGTGGGGGT…

NC_000023.11:67546514:GG:GGTGGGGGTGGTGGCGG

NC_000023.11:67546514:GG:GGTGGGGGT…

NC_000023.11:67546514:GG:GGTGGGGGTGGTGGCGG

ss4372947410 NC_000023.11:67546514::GGTGGGGGTGG…

NC_000023.11:67546514::GGTGGGGGTGGTGGCGGC

NC_000023.11:67546514:GG:GGTGGGGGT…

NC_000023.11:67546514:GG:GGTGGGGGTGGTGGCGGCGG

5349973643 NC_000023.11:67546514:GG:GGTGGGGGT…

NC_000023.11:67546514:GG:GGTGGGGGTGGTGGCGGCGG

NC_000023.11:67546514:GG:GGTGGGGGT…

NC_000023.11:67546514:GG:GGTGGGGGTGGTGGCGGCGG

5349973643 NC_000023.11:67546514:GG:GGTGGTGGC…

NC_000023.11:67546514:GG:GGTGGTGGCGGCGG

NC_000023.11:67546514:GG:GGTGGTGGC…

NC_000023.11:67546514:GG:GGTGGTGGCGGCGG

ss4372947411 NC_000023.11:67546514::GGTGGTGGGGG…

NC_000023.11:67546514::GGTGGTGGGGGTGGTGGCGGCGGC

NC_000023.11:67546514:GG:GGTGGTGGG…

NC_000023.11:67546514:GG:GGTGGTGGGGGTGGTGGCGGCGGCGG

ss4372947412 NC_000023.11:67546514::GGTGGTGGGGG…

NC_000023.11:67546514::GGTGGTGGGGGTGGTGGTGGCGGCGGC

NC_000023.11:67546514:GG:GGTGGTGGG…

NC_000023.11:67546514:GG:GGTGGTGGGGGTGGTGGTGGCGGCGGCGG

5349973643 NC_000023.11:67546514:GG:GGTGGTGGG…

NC_000023.11:67546514:GG:GGTGGTGGGGGTGGTGGTGGCGGCGGCGG

NC_000023.11:67546514:GG:GGTGGTGGG…

NC_000023.11:67546514:GG:GGTGGTGGGGGTGGTGGTGGCGGCGGCGG

Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs760580125

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad