Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs3032358

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chrX:67545317-67545385 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
del(GCA)17 / del(GCA)16 / del(GCA)…

del(GCA)17 / del(GCA)16 / del(GCA)15 / del(GCA)14 / del(GCA)13 / del(GCA)12 / del(GCA)11 / del(GCA)10 / del(GCA)9 / del(GCA)8 / del(GCA)7 / del(GCA)6 / del(GCA)5 / del(GCA)4 / del(GCA)3 / del(GCA)2 / delGCA / dupGCA / dup(GCA)2 / dup(GCA)3 / dup(GCA)4 / dup(GCA)5 / dup(GCA)6 / dup(GCA)7 / dup(GCA)8 / dup(GCA)9 / dup(GCA)10 / dup(GCA)11 / dup(GCA)12 / dup(GCA)13 / dup(GCA)14 / dup(GCA)15 / dup(GCA)16 / dup(GCA)17 / dup(GCA)18 / dup(GCA)19 / dup(GCA)20 / dup(GCA)21 / dup(GCA)22 / dup(GCA)23 / ins(GCA)24 / ins(GCA)25 / ins(GCA)26 / ins(GCA)27 / ins(GCA)28 / ins(GCA)29 / ins(GCA)30 / ins(GCA)31 / ins(GCA)32 / ins(GCA)33 / ins(GCA)34 / ins(GCA)35 / ins(GCA)36

Variation Type
Indel Insertion and Deletion
Frequency
dup(GCA)8=0.000042 (11/264690, TOPMED)
delGCA=0.07219 (1052/14572, ALFA)
Clinical Significance
Reported in ClinVar
Gene : Consequence
AR : Inframe Deletion
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[6]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[7]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[8]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[9]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[10]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[11]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[12]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[13]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[14]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[15]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[16]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[17]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[18]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[19]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[20]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[21]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[22]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[24]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[25]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[26]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[27]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[28]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[29]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[30]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[31]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[32]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[33]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[34]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[35]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[36]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[37]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[38]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[39]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[40]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[41]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[42]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[43]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[44]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[45]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[46]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[47]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[48]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[49]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[50]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[51]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[52]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[53]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[54]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[55]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[56]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[57]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[58]
GRCh38.p13 chr X NC_000023.11:g.67545317GCA[59]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[6]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[7]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[8]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[9]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[10]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[11]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[12]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[13]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[14]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[15]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[16]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[17]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[18]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[19]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[20]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[21]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[22]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[24]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[25]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[26]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[27]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[28]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[29]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[30]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[31]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[32]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[33]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[34]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[35]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[36]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[37]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[38]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[39]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[40]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[41]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[42]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[43]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[44]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[45]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[46]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[47]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[48]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[49]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[50]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[51]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[52]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[53]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[54]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[55]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[56]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[57]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[58]
GRCh37.p13 chr X NC_000023.10:g.66765159GCA[59]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[6]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[7]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[8]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[9]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[10]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[11]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[12]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[13]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[14]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[15]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[16]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[17]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[18]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[19]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[20]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[21]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[22]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[24]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[25]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[26]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[27]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[28]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[29]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[30]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[31]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[32]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[33]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[34]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[35]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[36]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[37]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[38]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[39]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[40]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[41]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[42]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[43]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[44]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[45]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[46]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[47]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[48]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[49]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[50]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[51]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[52]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[53]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[54]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[55]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[56]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[57]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[58]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286GCA[59]
LOC109504725 genomic region NG_052629.1:g.101GCA[6]
LOC109504725 genomic region NG_052629.1:g.101GCA[7]
LOC109504725 genomic region NG_052629.1:g.101GCA[8]
LOC109504725 genomic region NG_052629.1:g.101GCA[9]
LOC109504725 genomic region NG_052629.1:g.101GCA[10]
LOC109504725 genomic region NG_052629.1:g.101GCA[11]
LOC109504725 genomic region NG_052629.1:g.101GCA[12]
LOC109504725 genomic region NG_052629.1:g.101GCA[13]
LOC109504725 genomic region NG_052629.1:g.101GCA[14]
LOC109504725 genomic region NG_052629.1:g.101GCA[15]
LOC109504725 genomic region NG_052629.1:g.101GCA[16]
LOC109504725 genomic region NG_052629.1:g.101GCA[17]
LOC109504725 genomic region NG_052629.1:g.101GCA[18]
LOC109504725 genomic region NG_052629.1:g.101GCA[19]
LOC109504725 genomic region NG_052629.1:g.101GCA[20]
LOC109504725 genomic region NG_052629.1:g.101GCA[21]
LOC109504725 genomic region NG_052629.1:g.101GCA[22]
LOC109504725 genomic region NG_052629.1:g.101GCA[24]
LOC109504725 genomic region NG_052629.1:g.101GCA[25]
LOC109504725 genomic region NG_052629.1:g.101GCA[26]
LOC109504725 genomic region NG_052629.1:g.101GCA[27]
LOC109504725 genomic region NG_052629.1:g.101GCA[28]
LOC109504725 genomic region NG_052629.1:g.101GCA[29]
LOC109504725 genomic region NG_052629.1:g.101GCA[30]
LOC109504725 genomic region NG_052629.1:g.101GCA[31]
LOC109504725 genomic region NG_052629.1:g.101GCA[32]
LOC109504725 genomic region NG_052629.1:g.101GCA[33]
LOC109504725 genomic region NG_052629.1:g.101GCA[34]
LOC109504725 genomic region NG_052629.1:g.101GCA[35]
LOC109504725 genomic region NG_052629.1:g.101GCA[36]
LOC109504725 genomic region NG_052629.1:g.101GCA[37]
LOC109504725 genomic region NG_052629.1:g.101GCA[38]
LOC109504725 genomic region NG_052629.1:g.101GCA[39]
LOC109504725 genomic region NG_052629.1:g.101GCA[40]
LOC109504725 genomic region NG_052629.1:g.101GCA[41]
LOC109504725 genomic region NG_052629.1:g.101GCA[42]
LOC109504725 genomic region NG_052629.1:g.101GCA[43]
LOC109504725 genomic region NG_052629.1:g.101GCA[44]
LOC109504725 genomic region NG_052629.1:g.101GCA[45]
LOC109504725 genomic region NG_052629.1:g.101GCA[46]
LOC109504725 genomic region NG_052629.1:g.101GCA[47]
LOC109504725 genomic region NG_052629.1:g.101GCA[48]
LOC109504725 genomic region NG_052629.1:g.101GCA[49]
LOC109504725 genomic region NG_052629.1:g.101GCA[50]
LOC109504725 genomic region NG_052629.1:g.101GCA[51]
LOC109504725 genomic region NG_052629.1:g.101GCA[52]
LOC109504725 genomic region NG_052629.1:g.101GCA[53]
LOC109504725 genomic region NG_052629.1:g.101GCA[54]
LOC109504725 genomic region NG_052629.1:g.101GCA[55]
LOC109504725 genomic region NG_052629.1:g.101GCA[56]
LOC109504725 genomic region NG_052629.1:g.101GCA[57]
LOC109504725 genomic region NG_052629.1:g.101GCA[58]
LOC109504725 genomic region NG_052629.1:g.101GCA[59]
Gene: AR, androgen receptor (plus strand)
Molecule type Change Amino acid[Codon] SO Term
AR transcript variant 2 NM_001011645.3:c.-1613_-1…

NM_001011645.3:c.-1613_-1545=

N/A 5 Prime UTR Variant
AR transcript variant 3 NM_001348061.1:c.171GCA[6] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln64_Gl…

NP_001334990.1:p.Gln64_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQ (GlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[7] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln65_Gl…

NP_001334990.1:p.Gln65_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQ (GlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[8] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln66_Gl…

NP_001334990.1:p.Gln66_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[9] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln67_Gl…

NP_001334990.1:p.Gln67_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[10]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln68_Gl…

NP_001334990.1:p.Gln68_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[11]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln69_Gl…

NP_001334990.1:p.Gln69_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[12]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln70_Gl…

NP_001334990.1:p.Gln70_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[13]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln71_Gl…

NP_001334990.1:p.Gln71_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[14]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln72_Gl…

NP_001334990.1:p.Gln72_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[15]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln73_Gl…

NP_001334990.1:p.Gln73_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[16]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln74_Gl…

NP_001334990.1:p.Gln74_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[17]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln75_Gl…

NP_001334990.1:p.Gln75_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[18]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln76_Gl…

NP_001334990.1:p.Gln76_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[1…

NM_001348061.1:c.171GCA[19]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln77_Gl…

NP_001334990.1:p.Gln77_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[20]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln78_Gl…

NP_001334990.1:p.Gln78_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[21]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln79_Gl…

NP_001334990.1:p.Gln79_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[22]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln80del QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[24]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln80dup QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[25]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln79_Gl…

NP_001334990.1:p.Gln79_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[26]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln78_Gl…

NP_001334990.1:p.Gln78_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[27]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln77_Gl…

NP_001334990.1:p.Gln77_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[28]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln76_Gl…

NP_001334990.1:p.Gln76_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[2…

NM_001348061.1:c.171GCA[29]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln75_Gl…

NP_001334990.1:p.Gln75_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[30]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln74_Gl…

NP_001334990.1:p.Gln74_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[31]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln73_Gl…

NP_001334990.1:p.Gln73_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[32]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln72_Gl…

NP_001334990.1:p.Gln72_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[33]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln71_Gl…

NP_001334990.1:p.Gln71_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[34]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln70_Gl…

NP_001334990.1:p.Gln70_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[35]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln69_Gl…

NP_001334990.1:p.Gln69_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[36]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln68_Gl…

NP_001334990.1:p.Gln68_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[37]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln67_Gl…

NP_001334990.1:p.Gln67_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[38]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln66_Gl…

NP_001334990.1:p.Gln66_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[3…

NM_001348061.1:c.171GCA[39]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln65_Gl…

NP_001334990.1:p.Gln65_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[40]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln64_Gl…

NP_001334990.1:p.Gln64_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[41]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln63_Gl…

NP_001334990.1:p.Gln63_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[42]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln62_Gl…

NP_001334990.1:p.Gln62_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[43]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln61_Gl…

NP_001334990.1:p.Gln61_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[44]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln60_Gl…

NP_001334990.1:p.Gln60_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[45]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln59_Gl…

NP_001334990.1:p.Gln59_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[46]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Gln58_Gl…

NP_001334990.1:p.Gln58_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[47]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[48]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[4…

NM_001348061.1:c.171GCA[49]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[50]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[51]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[52]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[53]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[54]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[55]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[56]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[57]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[58]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 3 NM_001348061.1:c.171GCA[5…

NM_001348061.1:c.171GCA[59]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 3 NP_001334990.1:p.Glu81_Th…

NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[6] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln64_Gl…

NP_001334992.1:p.Gln64_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQ (GlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[7] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln65_Gl…

NP_001334992.1:p.Gln65_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQ (GlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[8] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln66_Gl…

NP_001334992.1:p.Gln66_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[9] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln67_Gl…

NP_001334992.1:p.Gln67_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[10]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln68_Gl…

NP_001334992.1:p.Gln68_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[11]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln69_Gl…

NP_001334992.1:p.Gln69_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[12]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln70_Gl…

NP_001334992.1:p.Gln70_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[13]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln71_Gl…

NP_001334992.1:p.Gln71_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[14]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln72_Gl…

NP_001334992.1:p.Gln72_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[15]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln73_Gl…

NP_001334992.1:p.Gln73_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[16]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln74_Gl…

NP_001334992.1:p.Gln74_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[17]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln75_Gl…

NP_001334992.1:p.Gln75_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[18]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln76_Gl…

NP_001334992.1:p.Gln76_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[1…

NM_001348063.1:c.171GCA[19]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln77_Gl…

NP_001334992.1:p.Gln77_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[20]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln78_Gl…

NP_001334992.1:p.Gln78_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[21]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln79_Gl…

NP_001334992.1:p.Gln79_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[22]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln80del QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[24]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln80dup QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[25]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln79_Gl…

NP_001334992.1:p.Gln79_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[26]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln78_Gl…

NP_001334992.1:p.Gln78_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[27]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln77_Gl…

NP_001334992.1:p.Gln77_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[28]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln76_Gl…

NP_001334992.1:p.Gln76_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[2…

NM_001348063.1:c.171GCA[29]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln75_Gl…

NP_001334992.1:p.Gln75_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[30]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln74_Gl…

NP_001334992.1:p.Gln74_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[31]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln73_Gl…

NP_001334992.1:p.Gln73_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[32]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln72_Gl…

NP_001334992.1:p.Gln72_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[33]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln71_Gl…

NP_001334992.1:p.Gln71_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[34]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln70_Gl…

NP_001334992.1:p.Gln70_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[35]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln69_Gl…

NP_001334992.1:p.Gln69_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[36]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln68_Gl…

NP_001334992.1:p.Gln68_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[37]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln67_Gl…

NP_001334992.1:p.Gln67_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[38]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln66_Gl…

NP_001334992.1:p.Gln66_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[3…

NM_001348063.1:c.171GCA[39]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln65_Gl…

NP_001334992.1:p.Gln65_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[40]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln64_Gl…

NP_001334992.1:p.Gln64_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[41]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln63_Gl…

NP_001334992.1:p.Gln63_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[42]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln62_Gl…

NP_001334992.1:p.Gln62_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[43]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln61_Gl…

NP_001334992.1:p.Gln61_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[44]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln60_Gl…

NP_001334992.1:p.Gln60_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[45]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln59_Gl…

NP_001334992.1:p.Gln59_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[46]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Gln58_Gl…

NP_001334992.1:p.Gln58_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[47]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[48]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[4…

NM_001348063.1:c.171GCA[49]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[50]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[51]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[52]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[53]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[54]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[55]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[56]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[57]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[58]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 4 NM_001348063.1:c.171GCA[5…

NM_001348063.1:c.171GCA[59]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 4 NP_001334992.1:p.Glu81_Th…

NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[6] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln64_Gl…

NP_001334993.1:p.Gln64_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQ (GlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[7] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln65_Gl…

NP_001334993.1:p.Gln65_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQ (GlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[8] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln66_Gl…

NP_001334993.1:p.Gln66_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[9] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln67_Gl…

NP_001334993.1:p.Gln67_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[10]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln68_Gl…

NP_001334993.1:p.Gln68_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[11]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln69_Gl…

NP_001334993.1:p.Gln69_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[12]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln70_Gl…

NP_001334993.1:p.Gln70_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[13]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln71_Gl…

NP_001334993.1:p.Gln71_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[14]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln72_Gl…

NP_001334993.1:p.Gln72_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[15]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln73_Gl…

NP_001334993.1:p.Gln73_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[16]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln74_Gl…

NP_001334993.1:p.Gln74_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[17]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln75_Gl…

NP_001334993.1:p.Gln75_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[18]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln76_Gl…

NP_001334993.1:p.Gln76_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[1…

NM_001348064.1:c.171GCA[19]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln77_Gl…

NP_001334993.1:p.Gln77_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[20]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln78_Gl…

NP_001334993.1:p.Gln78_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[21]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln79_Gl…

NP_001334993.1:p.Gln79_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[22]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln80del QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[24]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln80dup QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[25]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln79_Gl…

NP_001334993.1:p.Gln79_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[26]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln78_Gl…

NP_001334993.1:p.Gln78_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[27]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln77_Gl…

NP_001334993.1:p.Gln77_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[28]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln76_Gl…

NP_001334993.1:p.Gln76_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[2…

NM_001348064.1:c.171GCA[29]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln75_Gl…

NP_001334993.1:p.Gln75_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[30]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln74_Gl…

NP_001334993.1:p.Gln74_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[31]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln73_Gl…

NP_001334993.1:p.Gln73_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[32]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln72_Gl…

NP_001334993.1:p.Gln72_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[33]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln71_Gl…

NP_001334993.1:p.Gln71_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[34]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln70_Gl…

NP_001334993.1:p.Gln70_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[35]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln69_Gl…

NP_001334993.1:p.Gln69_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[36]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln68_Gl…

NP_001334993.1:p.Gln68_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[37]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln67_Gl…

NP_001334993.1:p.Gln67_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[38]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln66_Gl…

NP_001334993.1:p.Gln66_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[3…

NM_001348064.1:c.171GCA[39]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln65_Gl…

NP_001334993.1:p.Gln65_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[40]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln64_Gl…

NP_001334993.1:p.Gln64_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[41]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln63_Gl…

NP_001334993.1:p.Gln63_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[42]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln62_Gl…

NP_001334993.1:p.Gln62_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[43]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln61_Gl…

NP_001334993.1:p.Gln61_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[44]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln60_Gl…

NP_001334993.1:p.Gln60_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[45]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln59_Gl…

NP_001334993.1:p.Gln59_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[46]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Gln58_Gl…

NP_001334993.1:p.Gln58_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[47]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[48]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[4…

NM_001348064.1:c.171GCA[49]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[50]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[51]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[52]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[53]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[54]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[55]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[56]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[57]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[58]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 5 NM_001348064.1:c.171GCA[5…

NM_001348064.1:c.171GCA[59]

QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 5 NP_001334993.1:p.Glu81_Th…

NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[6] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln64_Gln80…

NP_000035.2:p.Gln64_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQ (GlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[7] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln65_Gln80…

NP_000035.2:p.Gln65_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQ (GlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[8] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln66_Gln80…

NP_000035.2:p.Gln66_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[9] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln67_Gln80…

NP_000035.2:p.Gln67_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[10] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln68_Gln80…

NP_000035.2:p.Gln68_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[11] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln69_Gln80…

NP_000035.2:p.Gln69_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[12] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln70_Gln80…

NP_000035.2:p.Gln70_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[13] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln71_Gln80…

NP_000035.2:p.Gln71_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[14] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln72_Gln80…

NP_000035.2:p.Gln72_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[15] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln73_Gln80…

NP_000035.2:p.Gln73_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[16] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln74_Gln80…

NP_000035.2:p.Gln74_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[17] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln75_Gln80…

NP_000035.2:p.Gln75_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[18] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln76_Gln80…

NP_000035.2:p.Gln76_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[19] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln77_Gln80…

NP_000035.2:p.Gln77_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[20] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln78_Gln80…

NP_000035.2:p.Gln78_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[21] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln79_Gln80…

NP_000035.2:p.Gln79_Gln80del

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[22] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAGC] > QQQQQQQQQQQQQQQQQQQQQQ [CAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln80del QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Deletion
AR transcript variant 1 NM_000044.6:c.171GCA[24] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln80dup QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[25] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln79_Gln80…

NP_000035.2:p.Gln79_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[26] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln78_Gln80…

NP_000035.2:p.Gln78_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[27] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln77_Gln80…

NP_000035.2:p.Gln77_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[28] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln76_Gln80…

NP_000035.2:p.Gln76_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[29] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln75_Gln80…

NP_000035.2:p.Gln75_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[30] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln74_Gln80…

NP_000035.2:p.Gln74_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[31] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln73_Gln80…

NP_000035.2:p.Gln73_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[32] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln72_Gln80…

NP_000035.2:p.Gln72_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[33] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln71_Gln80…

NP_000035.2:p.Gln71_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[34] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln70_Gln80…

NP_000035.2:p.Gln70_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[35] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln69_Gln80…

NP_000035.2:p.Gln69_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[36] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln68_Gln80…

NP_000035.2:p.Gln68_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[37] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln67_Gln80…

NP_000035.2:p.Gln67_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[38] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln66_Gln80…

NP_000035.2:p.Gln66_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[39] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln65_Gln80…

NP_000035.2:p.Gln65_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[40] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln64_Gln80…

NP_000035.2:p.Gln64_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[41] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln63_Gln80…

NP_000035.2:p.Gln63_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[42] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln62_Gln80…

NP_000035.2:p.Gln62_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[43] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln61_Gln80…

NP_000035.2:p.Gln61_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[44] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln60_Gln80…

NP_000035.2:p.Gln60_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[45] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln59_Gln80…

NP_000035.2:p.Gln59_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[46] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Gln58_Gln80…

NP_000035.2:p.Gln58_Gln80dup

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[47] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[48] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[49] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[50] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[51] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[52] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[53] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[54] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[55] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[56] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[57] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[58] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
AR transcript variant 1 NM_000044.6:c.171GCA[59] QQQQQQQQQQQQQQQQQQQQQQQ [C...

QQQQQQQQQQQQQQQQQQQQQQQ [CAA] > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ [CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAA]

Coding Sequence Variant
androgen receptor isoform 1 NP_000035.2:p.Glu81_Thr82…

NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln

QQQQQQQQQQQQQQQQQQQQQQQ (…

QQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln) > QQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQ (GlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln)

Inframe Insertion
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Allele: del(GCA)11 (allele ID: 508182 )
ClinVar Accession Disease Names Clinical Significance
RCV000610545.1 not specified Likely-Benign
Allele: del(GCA)9 (allele ID: 508192 )
ClinVar Accession Disease Names Clinical Significance
RCV000605050.1 not specified Likely-Benign
Allele: del(GCA)8 (allele ID: 534907 )
ClinVar Accession Disease Names Clinical Significance
RCV000640479.3 Androgen resistance syndrome,Kennedy disease Benign
Allele: del(GCA)7 (allele ID: 430876 )
ClinVar Accession Disease Names Clinical Significance
RCV000501130.2 not specified Likely-Benign
Allele: del(GCA)6 (allele ID: 411439 )
ClinVar Accession Disease Names Clinical Significance
RCV000478989.2 not specified Likely-Benign
Allele: del(GCA)5 (allele ID: 430877 )
ClinVar Accession Disease Names Clinical Significance
RCV000502496.1 not specified Benign
RCV000534320.3 Androgen resistance syndrome,Kennedy disease Benign
Allele: del(GCA)4 (allele ID: 472174 )
ClinVar Accession Disease Names Clinical Significance
RCV000526224.3 Androgen resistance syndrome,Kennedy disease Benign
Allele: del(GCA)3 (allele ID: 209141 )
ClinVar Accession Disease Names Clinical Significance
RCV000194669.2 not specified Benign
RCV000514680.1 not provided Likely-Benign
RCV000538518.1 Androgen resistance syndrome,Kennedy disease Benign
Allele: dupGCA (allele ID: 430878 )
ClinVar Accession Disease Names Clinical Significance
RCV000502054.2 not specified Likely-Benign
RCV000539588.4 not provided Likely-Benign
RCV001088480.1 Androgen resistance syndrome,Kennedy disease Benign
Allele: dup(GCA)2 (allele ID: 274659 )
ClinVar Accession Disease Names Clinical Significance
RCV000372316.1 not specified Benign
Allele: dup(GCA)5 (allele ID: 471928 )
ClinVar Accession Disease Names Clinical Significance
RCV000550088.3 Androgen resistance syndrome,Kennedy disease Benign
Allele: dup(GCA)7 (allele ID: 508690 )
ClinVar Accession Disease Names Clinical Significance
RCV000614551.1 not specified Likely-Benign
Allele: dup(GCA)8 (allele ID: 471662 )
ClinVar Accession Disease Names Clinical Significance
RCV000526288.2 not provided Benign
RCV000600941.1 not specified Likely-Benign
Allele: dup(GCA)9 (allele ID: 411438 )
ClinVar Accession Disease Names Clinical Significance
RCV000486744.1 not specified Likely-Benign
RCV000550433.3 Androgen resistance syndrome,Kennedy disease Benign
Allele: dup(GCA)10 (allele ID: 411437 )
ClinVar Accession Disease Names Clinical Significance
RCV000482993.1 not specified Likely-Benign
Allele: dup(GCA)13 (allele ID: 404864 )
ClinVar Accession Disease Names Clinical Significance
RCV000485802.1 Kennedy disease Uncertain-Significance

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 14572 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.64013 GCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00014, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.05380, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.04570, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.04776, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.05662, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.05861, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.07219, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.02505, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000
European Sub 11250 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.61396 GCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00009, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.04533, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.04738, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.05387, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06258, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06347, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.08116, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.03218, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00000
African Sub 804 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.858 GCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.001, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.050, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.027, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.014, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.020, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.012, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.016, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.001, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000
African Others Sub 20 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.90 GCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.10, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00
African American Sub 784 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.857 GCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.001, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.051, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.026, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.014, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.020, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.013, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.017, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.001, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.000
Asian Sub 82 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.55 GCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.17, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.09, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.02, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.05, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00
East Asian Sub 50 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.54 GCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.18, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.04, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.08, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.04, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00
Other Asian Sub 32 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.56 GCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.16, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.12, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.03, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.06, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00
Latin American 1 Sub 16 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=1.00 GCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00
Latin American 2 Sub 96 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=1.00 GCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00
South Asian Sub 18 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=1.00 GCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.00
Other Sub 2306 GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.6748 GCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0954, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0451, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0334, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0434, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0546, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0525, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0009, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000, GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA=0.0000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 -

No frequency provided

dup(GCA)8=0.000042
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement (GCA)23= del(GCA)17 del(GCA)16 del(GCA)15 del(GCA)14 del(GCA)13 del(GCA)12 del(GCA)11 del(GCA)10 del(GCA)9 del(GCA)8 del(GCA)7 del(GCA)6 del(GCA)5 del(GCA)4 del(GCA)3 del(GCA)2 delGCA dupGCA dup(GCA)2 dup(GCA)3 dup(GCA)4 dup(GCA)5 dup(GCA)6 dup(GCA)7 dup(GCA)8 dup(GCA)9 dup(GCA)10 dup(GCA)11 dup(GCA)12 dup(GCA)13 dup(GCA)14 dup(GCA)15 dup(GCA)16 dup(GCA)17 dup(GCA)18 dup(GCA)19 dup(GCA)20 dup(GCA)21 dup(GCA)22 dup(GCA)23 ins(GCA)24 ins(GCA)25 ins(GCA)26 ins(GCA)27 ins(GCA)28 ins(GCA)29 ins(GCA)30 ins(GCA)31 ins(GCA)32 ins(GCA)33 ins(GCA)34 ins(GCA)35 ins(GCA)36
GRCh38.p13 chr X NC_000023.11:g.67545317_67545385= NC_000023.11:g.67545317GCA[6] NC_000023.11:g.67545317GCA[7] NC_000023.11:g.67545317GCA[8] NC_000023.11:g.67545317GCA[9] NC_000023.11:g.67545317GCA[10] NC_000023.11:g.67545317GCA[11] NC_000023.11:g.67545317GCA[12] NC_000023.11:g.67545317GCA[13] NC_000023.11:g.67545317GCA[14] NC_000023.11:g.67545317GCA[15] NC_000023.11:g.67545317GCA[16] NC_000023.11:g.67545317GCA[17] NC_000023.11:g.67545317GCA[18] NC_000023.11:g.67545317GCA[19] NC_000023.11:g.67545317GCA[20] NC_000023.11:g.67545317GCA[21] NC_000023.11:g.67545317GCA[22] NC_000023.11:g.67545317GCA[24] NC_000023.11:g.67545317GCA[25] NC_000023.11:g.67545317GCA[26] NC_000023.11:g.67545317GCA[27] NC_000023.11:g.67545317GCA[28] NC_000023.11:g.67545317GCA[29] NC_000023.11:g.67545317GCA[30] NC_000023.11:g.67545317GCA[31] NC_000023.11:g.67545317GCA[32] NC_000023.11:g.67545317GCA[33] NC_000023.11:g.67545317GCA[34] NC_000023.11:g.67545317GCA[35] NC_000023.11:g.67545317GCA[36] NC_000023.11:g.67545317GCA[37] NC_000023.11:g.67545317GCA[38] NC_000023.11:g.67545317GCA[39] NC_000023.11:g.67545317GCA[40] NC_000023.11:g.67545317GCA[41] NC_000023.11:g.67545317GCA[42] NC_000023.11:g.67545317GCA[43] NC_000023.11:g.67545317GCA[44] NC_000023.11:g.67545317GCA[45] NC_000023.11:g.67545317GCA[46] NC_000023.11:g.67545317GCA[47] NC_000023.11:g.67545317GCA[48] NC_000023.11:g.67545317GCA[49] NC_000023.11:g.67545317GCA[50] NC_000023.11:g.67545317GCA[51] NC_000023.11:g.67545317GCA[52] NC_000023.11:g.67545317GCA[53] NC_000023.11:g.67545317GCA[54] NC_000023.11:g.67545317GCA[55] NC_000023.11:g.67545317GCA[56] NC_000023.11:g.67545317GCA[57] NC_000023.11:g.67545317GCA[58] NC_000023.11:g.67545317GCA[59]
GRCh37.p13 chr X NC_000023.10:g.66765159_66765227= NC_000023.10:g.66765159GCA[6] NC_000023.10:g.66765159GCA[7] NC_000023.10:g.66765159GCA[8] NC_000023.10:g.66765159GCA[9] NC_000023.10:g.66765159GCA[10] NC_000023.10:g.66765159GCA[11] NC_000023.10:g.66765159GCA[12] NC_000023.10:g.66765159GCA[13] NC_000023.10:g.66765159GCA[14] NC_000023.10:g.66765159GCA[15] NC_000023.10:g.66765159GCA[16] NC_000023.10:g.66765159GCA[17] NC_000023.10:g.66765159GCA[18] NC_000023.10:g.66765159GCA[19] NC_000023.10:g.66765159GCA[20] NC_000023.10:g.66765159GCA[21] NC_000023.10:g.66765159GCA[22] NC_000023.10:g.66765159GCA[24] NC_000023.10:g.66765159GCA[25] NC_000023.10:g.66765159GCA[26] NC_000023.10:g.66765159GCA[27] NC_000023.10:g.66765159GCA[28] NC_000023.10:g.66765159GCA[29] NC_000023.10:g.66765159GCA[30] NC_000023.10:g.66765159GCA[31] NC_000023.10:g.66765159GCA[32] NC_000023.10:g.66765159GCA[33] NC_000023.10:g.66765159GCA[34] NC_000023.10:g.66765159GCA[35] NC_000023.10:g.66765159GCA[36] NC_000023.10:g.66765159GCA[37] NC_000023.10:g.66765159GCA[38] NC_000023.10:g.66765159GCA[39] NC_000023.10:g.66765159GCA[40] NC_000023.10:g.66765159GCA[41] NC_000023.10:g.66765159GCA[42] NC_000023.10:g.66765159GCA[43] NC_000023.10:g.66765159GCA[44] NC_000023.10:g.66765159GCA[45] NC_000023.10:g.66765159GCA[46] NC_000023.10:g.66765159GCA[47] NC_000023.10:g.66765159GCA[48] NC_000023.10:g.66765159GCA[49] NC_000023.10:g.66765159GCA[50] NC_000023.10:g.66765159GCA[51] NC_000023.10:g.66765159GCA[52] NC_000023.10:g.66765159GCA[53] NC_000023.10:g.66765159GCA[54] NC_000023.10:g.66765159GCA[55] NC_000023.10:g.66765159GCA[56] NC_000023.10:g.66765159GCA[57] NC_000023.10:g.66765159GCA[58] NC_000023.10:g.66765159GCA[59]
AR RefSeqGene (LRG_1406) NG_009014.2:g.6286_6354= NG_009014.2:g.6286GCA[6] NG_009014.2:g.6286GCA[7] NG_009014.2:g.6286GCA[8] NG_009014.2:g.6286GCA[9] NG_009014.2:g.6286GCA[10] NG_009014.2:g.6286GCA[11] NG_009014.2:g.6286GCA[12] NG_009014.2:g.6286GCA[13] NG_009014.2:g.6286GCA[14] NG_009014.2:g.6286GCA[15] NG_009014.2:g.6286GCA[16] NG_009014.2:g.6286GCA[17] NG_009014.2:g.6286GCA[18] NG_009014.2:g.6286GCA[19] NG_009014.2:g.6286GCA[20] NG_009014.2:g.6286GCA[21] NG_009014.2:g.6286GCA[22] NG_009014.2:g.6286GCA[24] NG_009014.2:g.6286GCA[25] NG_009014.2:g.6286GCA[26] NG_009014.2:g.6286GCA[27] NG_009014.2:g.6286GCA[28] NG_009014.2:g.6286GCA[29] NG_009014.2:g.6286GCA[30] NG_009014.2:g.6286GCA[31] NG_009014.2:g.6286GCA[32] NG_009014.2:g.6286GCA[33] NG_009014.2:g.6286GCA[34] NG_009014.2:g.6286GCA[35] NG_009014.2:g.6286GCA[36] NG_009014.2:g.6286GCA[37] NG_009014.2:g.6286GCA[38] NG_009014.2:g.6286GCA[39] NG_009014.2:g.6286GCA[40] NG_009014.2:g.6286GCA[41] NG_009014.2:g.6286GCA[42] NG_009014.2:g.6286GCA[43] NG_009014.2:g.6286GCA[44] NG_009014.2:g.6286GCA[45] NG_009014.2:g.6286GCA[46] NG_009014.2:g.6286GCA[47] NG_009014.2:g.6286GCA[48] NG_009014.2:g.6286GCA[49] NG_009014.2:g.6286GCA[50] NG_009014.2:g.6286GCA[51] NG_009014.2:g.6286GCA[52] NG_009014.2:g.6286GCA[53] NG_009014.2:g.6286GCA[54] NG_009014.2:g.6286GCA[55] NG_009014.2:g.6286GCA[56] NG_009014.2:g.6286GCA[57] NG_009014.2:g.6286GCA[58] NG_009014.2:g.6286GCA[59]
AR transcript variant 1 NM_000044.6:c.171_239= NM_000044.6:c.171GCA[6] NM_000044.6:c.171GCA[7] NM_000044.6:c.171GCA[8] NM_000044.6:c.171GCA[9] NM_000044.6:c.171GCA[10] NM_000044.6:c.171GCA[11] NM_000044.6:c.171GCA[12] NM_000044.6:c.171GCA[13] NM_000044.6:c.171GCA[14] NM_000044.6:c.171GCA[15] NM_000044.6:c.171GCA[16] NM_000044.6:c.171GCA[17] NM_000044.6:c.171GCA[18] NM_000044.6:c.171GCA[19] NM_000044.6:c.171GCA[20] NM_000044.6:c.171GCA[21] NM_000044.6:c.171GCA[22] NM_000044.6:c.171GCA[24] NM_000044.6:c.171GCA[25] NM_000044.6:c.171GCA[26] NM_000044.6:c.171GCA[27] NM_000044.6:c.171GCA[28] NM_000044.6:c.171GCA[29] NM_000044.6:c.171GCA[30] NM_000044.6:c.171GCA[31] NM_000044.6:c.171GCA[32] NM_000044.6:c.171GCA[33] NM_000044.6:c.171GCA[34] NM_000044.6:c.171GCA[35] NM_000044.6:c.171GCA[36] NM_000044.6:c.171GCA[37] NM_000044.6:c.171GCA[38] NM_000044.6:c.171GCA[39] NM_000044.6:c.171GCA[40] NM_000044.6:c.171GCA[41] NM_000044.6:c.171GCA[42] NM_000044.6:c.171GCA[43] NM_000044.6:c.171GCA[44] NM_000044.6:c.171GCA[45] NM_000044.6:c.171GCA[46] NM_000044.6:c.171GCA[47] NM_000044.6:c.171GCA[48] NM_000044.6:c.171GCA[49] NM_000044.6:c.171GCA[50] NM_000044.6:c.171GCA[51] NM_000044.6:c.171GCA[52] NM_000044.6:c.171GCA[53] NM_000044.6:c.171GCA[54] NM_000044.6:c.171GCA[55] NM_000044.6:c.171GCA[56] NM_000044.6:c.171GCA[57] NM_000044.6:c.171GCA[58] NM_000044.6:c.171GCA[59]
AR transcript variant 1 NM_000044.5:c.171_239= NM_000044.5:c.171GCA[6] NM_000044.5:c.171GCA[7] NM_000044.5:c.171GCA[8] NM_000044.5:c.171GCA[9] NM_000044.5:c.171GCA[10] NM_000044.5:c.171GCA[11] NM_000044.5:c.171GCA[12] NM_000044.5:c.171GCA[13] NM_000044.5:c.171GCA[14] NM_000044.5:c.171GCA[15] NM_000044.5:c.171GCA[16] NM_000044.5:c.171GCA[17] NM_000044.5:c.171GCA[18] NM_000044.5:c.171GCA[19] NM_000044.5:c.171GCA[20] NM_000044.5:c.171GCA[21] NM_000044.5:c.171GCA[22] NM_000044.5:c.171GCA[24] NM_000044.5:c.171GCA[25] NM_000044.5:c.171GCA[26] NM_000044.5:c.171GCA[27] NM_000044.5:c.171GCA[28] NM_000044.5:c.171GCA[29] NM_000044.5:c.171GCA[30] NM_000044.5:c.171GCA[31] NM_000044.5:c.171GCA[32] NM_000044.5:c.171GCA[33] NM_000044.5:c.171GCA[34] NM_000044.5:c.171GCA[35] NM_000044.5:c.171GCA[36] NM_000044.5:c.171GCA[37] NM_000044.5:c.171GCA[38] NM_000044.5:c.171GCA[39] NM_000044.5:c.171GCA[40] NM_000044.5:c.171GCA[41] NM_000044.5:c.171GCA[42] NM_000044.5:c.171GCA[43] NM_000044.5:c.171GCA[44] NM_000044.5:c.171GCA[45] NM_000044.5:c.171GCA[46] NM_000044.5:c.171GCA[47] NM_000044.5:c.171GCA[48] NM_000044.5:c.171GCA[49] NM_000044.5:c.171GCA[50] NM_000044.5:c.171GCA[51] NM_000044.5:c.171GCA[52] NM_000044.5:c.171GCA[53] NM_000044.5:c.171GCA[54] NM_000044.5:c.171GCA[55] NM_000044.5:c.171GCA[56] NM_000044.5:c.171GCA[57] NM_000044.5:c.171GCA[58] NM_000044.5:c.171GCA[59]
AR transcript variant 1 NM_000044.4:c.171_239= NM_000044.4:c.171GCA[6] NM_000044.4:c.171GCA[7] NM_000044.4:c.171GCA[8] NM_000044.4:c.171GCA[9] NM_000044.4:c.171GCA[10] NM_000044.4:c.171GCA[11] NM_000044.4:c.171GCA[12] NM_000044.4:c.171GCA[13] NM_000044.4:c.171GCA[14] NM_000044.4:c.171GCA[15] NM_000044.4:c.171GCA[16] NM_000044.4:c.171GCA[17] NM_000044.4:c.171GCA[18] NM_000044.4:c.171GCA[19] NM_000044.4:c.171GCA[20] NM_000044.4:c.171GCA[21] NM_000044.4:c.171GCA[22] NM_000044.4:c.171GCA[24] NM_000044.4:c.171GCA[25] NM_000044.4:c.171GCA[26] NM_000044.4:c.171GCA[27] NM_000044.4:c.171GCA[28] NM_000044.4:c.171GCA[29] NM_000044.4:c.171GCA[30] NM_000044.4:c.171GCA[31] NM_000044.4:c.171GCA[32] NM_000044.4:c.171GCA[33] NM_000044.4:c.171GCA[34] NM_000044.4:c.171GCA[35] NM_000044.4:c.171GCA[36] NM_000044.4:c.171GCA[37] NM_000044.4:c.171GCA[38] NM_000044.4:c.171GCA[39] NM_000044.4:c.171GCA[40] NM_000044.4:c.171GCA[41] NM_000044.4:c.171GCA[42] NM_000044.4:c.171GCA[43] NM_000044.4:c.171GCA[44] NM_000044.4:c.171GCA[45] NM_000044.4:c.171GCA[46] NM_000044.4:c.171GCA[47] NM_000044.4:c.171GCA[48] NM_000044.4:c.171GCA[49] NM_000044.4:c.171GCA[50] NM_000044.4:c.171GCA[51] NM_000044.4:c.171GCA[52] NM_000044.4:c.171GCA[53] NM_000044.4:c.171GCA[54] NM_000044.4:c.171GCA[55] NM_000044.4:c.171GCA[56] NM_000044.4:c.171GCA[57] NM_000044.4:c.171GCA[58] NM_000044.4:c.171GCA[59]
AR transcript variant 1 NM_000044.3:c.171_239= NM_000044.3:c.171GCA[6] NM_000044.3:c.171GCA[7] NM_000044.3:c.171GCA[8] NM_000044.3:c.171GCA[9] NM_000044.3:c.171GCA[10] NM_000044.3:c.171GCA[11] NM_000044.3:c.171GCA[12] NM_000044.3:c.171GCA[13] NM_000044.3:c.171GCA[14] NM_000044.3:c.171GCA[15] NM_000044.3:c.171GCA[16] NM_000044.3:c.171GCA[17] NM_000044.3:c.171GCA[18] NM_000044.3:c.171GCA[19] NM_000044.3:c.171GCA[20] NM_000044.3:c.171GCA[21] NM_000044.3:c.171GCA[22] NM_000044.3:c.171GCA[24] NM_000044.3:c.171GCA[25] NM_000044.3:c.171GCA[26] NM_000044.3:c.171GCA[27] NM_000044.3:c.171GCA[28] NM_000044.3:c.171GCA[29] NM_000044.3:c.171GCA[30] NM_000044.3:c.171GCA[31] NM_000044.3:c.171GCA[32] NM_000044.3:c.171GCA[33] NM_000044.3:c.171GCA[34] NM_000044.3:c.171GCA[35] NM_000044.3:c.171GCA[36] NM_000044.3:c.171GCA[37] NM_000044.3:c.171GCA[38] NM_000044.3:c.171GCA[39] NM_000044.3:c.171GCA[40] NM_000044.3:c.171GCA[41] NM_000044.3:c.171GCA[42] NM_000044.3:c.171GCA[43] NM_000044.3:c.171GCA[44] NM_000044.3:c.171GCA[45] NM_000044.3:c.171GCA[46] NM_000044.3:c.171GCA[47] NM_000044.3:c.171GCA[48] NM_000044.3:c.171GCA[49] NM_000044.3:c.171GCA[50] NM_000044.3:c.171GCA[51] NM_000044.3:c.171GCA[52] NM_000044.3:c.171GCA[53] NM_000044.3:c.171GCA[54] NM_000044.3:c.171GCA[55] NM_000044.3:c.171GCA[56] NM_000044.3:c.171GCA[57] NM_000044.3:c.171GCA[58] NM_000044.3:c.171GCA[59]
AR transcript variant 2 NM_001011645.3:c.-1613_-1545= NM_001011645.3:c.-1613GCA[6] NM_001011645.3:c.-1613GCA[7] NM_001011645.3:c.-1613GCA[8] NM_001011645.3:c.-1613GCA[9] NM_001011645.3:c.-1613GCA[10] NM_001011645.3:c.-1613GCA[11] NM_001011645.3:c.-1613GCA[12] NM_001011645.3:c.-1613GCA[13] NM_001011645.3:c.-1613GCA[14] NM_001011645.3:c.-1613GCA[15] NM_001011645.3:c.-1613GCA[16] NM_001011645.3:c.-1613GCA[17] NM_001011645.3:c.-1613GCA[18] NM_001011645.3:c.-1613GCA[19] NM_001011645.3:c.-1613GCA[20] NM_001011645.3:c.-1613GCA[21] NM_001011645.3:c.-1613GCA[22] NM_001011645.3:c.-1613GCA[24] NM_001011645.3:c.-1613GCA[25] NM_001011645.3:c.-1613GCA[26] NM_001011645.3:c.-1613GCA[27] NM_001011645.3:c.-1613GCA[28] NM_001011645.3:c.-1613GCA[29] NM_001011645.3:c.-1613GCA[30] NM_001011645.3:c.-1613GCA[31] NM_001011645.3:c.-1613GCA[32] NM_001011645.3:c.-1613GCA[33] NM_001011645.3:c.-1613GCA[34] NM_001011645.3:c.-1613GCA[35] NM_001011645.3:c.-1613GCA[36] NM_001011645.3:c.-1613GCA[37] NM_001011645.3:c.-1613GCA[38] NM_001011645.3:c.-1613GCA[39] NM_001011645.3:c.-1613GCA[40] NM_001011645.3:c.-1613GCA[41] NM_001011645.3:c.-1613GCA[42] NM_001011645.3:c.-1613GCA[43] NM_001011645.3:c.-1613GCA[44] NM_001011645.3:c.-1613GCA[45] NM_001011645.3:c.-1613GCA[46] NM_001011645.3:c.-1613GCA[47] NM_001011645.3:c.-1613GCA[48] NM_001011645.3:c.-1613GCA[49] NM_001011645.3:c.-1613GCA[50] NM_001011645.3:c.-1613GCA[51] NM_001011645.3:c.-1613GCA[52] NM_001011645.3:c.-1613GCA[53] NM_001011645.3:c.-1613GCA[54] NM_001011645.3:c.-1613GCA[55] NM_001011645.3:c.-1613GCA[56] NM_001011645.3:c.-1613GCA[57] NM_001011645.3:c.-1613GCA[58] NM_001011645.3:c.-1613GCA[59]
AR transcript variant 3 NM_001348061.1:c.171_239= NM_001348061.1:c.171GCA[6] NM_001348061.1:c.171GCA[7] NM_001348061.1:c.171GCA[8] NM_001348061.1:c.171GCA[9] NM_001348061.1:c.171GCA[10] NM_001348061.1:c.171GCA[11] NM_001348061.1:c.171GCA[12] NM_001348061.1:c.171GCA[13] NM_001348061.1:c.171GCA[14] NM_001348061.1:c.171GCA[15] NM_001348061.1:c.171GCA[16] NM_001348061.1:c.171GCA[17] NM_001348061.1:c.171GCA[18] NM_001348061.1:c.171GCA[19] NM_001348061.1:c.171GCA[20] NM_001348061.1:c.171GCA[21] NM_001348061.1:c.171GCA[22] NM_001348061.1:c.171GCA[24] NM_001348061.1:c.171GCA[25] NM_001348061.1:c.171GCA[26] NM_001348061.1:c.171GCA[27] NM_001348061.1:c.171GCA[28] NM_001348061.1:c.171GCA[29] NM_001348061.1:c.171GCA[30] NM_001348061.1:c.171GCA[31] NM_001348061.1:c.171GCA[32] NM_001348061.1:c.171GCA[33] NM_001348061.1:c.171GCA[34] NM_001348061.1:c.171GCA[35] NM_001348061.1:c.171GCA[36] NM_001348061.1:c.171GCA[37] NM_001348061.1:c.171GCA[38] NM_001348061.1:c.171GCA[39] NM_001348061.1:c.171GCA[40] NM_001348061.1:c.171GCA[41] NM_001348061.1:c.171GCA[42] NM_001348061.1:c.171GCA[43] NM_001348061.1:c.171GCA[44] NM_001348061.1:c.171GCA[45] NM_001348061.1:c.171GCA[46] NM_001348061.1:c.171GCA[47] NM_001348061.1:c.171GCA[48] NM_001348061.1:c.171GCA[49] NM_001348061.1:c.171GCA[50] NM_001348061.1:c.171GCA[51] NM_001348061.1:c.171GCA[52] NM_001348061.1:c.171GCA[53] NM_001348061.1:c.171GCA[54] NM_001348061.1:c.171GCA[55] NM_001348061.1:c.171GCA[56] NM_001348061.1:c.171GCA[57] NM_001348061.1:c.171GCA[58] NM_001348061.1:c.171GCA[59]
AR transcript variant 5 NM_001348064.1:c.171_239= NM_001348064.1:c.171GCA[6] NM_001348064.1:c.171GCA[7] NM_001348064.1:c.171GCA[8] NM_001348064.1:c.171GCA[9] NM_001348064.1:c.171GCA[10] NM_001348064.1:c.171GCA[11] NM_001348064.1:c.171GCA[12] NM_001348064.1:c.171GCA[13] NM_001348064.1:c.171GCA[14] NM_001348064.1:c.171GCA[15] NM_001348064.1:c.171GCA[16] NM_001348064.1:c.171GCA[17] NM_001348064.1:c.171GCA[18] NM_001348064.1:c.171GCA[19] NM_001348064.1:c.171GCA[20] NM_001348064.1:c.171GCA[21] NM_001348064.1:c.171GCA[22] NM_001348064.1:c.171GCA[24] NM_001348064.1:c.171GCA[25] NM_001348064.1:c.171GCA[26] NM_001348064.1:c.171GCA[27] NM_001348064.1:c.171GCA[28] NM_001348064.1:c.171GCA[29] NM_001348064.1:c.171GCA[30] NM_001348064.1:c.171GCA[31] NM_001348064.1:c.171GCA[32] NM_001348064.1:c.171GCA[33] NM_001348064.1:c.171GCA[34] NM_001348064.1:c.171GCA[35] NM_001348064.1:c.171GCA[36] NM_001348064.1:c.171GCA[37] NM_001348064.1:c.171GCA[38] NM_001348064.1:c.171GCA[39] NM_001348064.1:c.171GCA[40] NM_001348064.1:c.171GCA[41] NM_001348064.1:c.171GCA[42] NM_001348064.1:c.171GCA[43] NM_001348064.1:c.171GCA[44] NM_001348064.1:c.171GCA[45] NM_001348064.1:c.171GCA[46] NM_001348064.1:c.171GCA[47] NM_001348064.1:c.171GCA[48] NM_001348064.1:c.171GCA[49] NM_001348064.1:c.171GCA[50] NM_001348064.1:c.171GCA[51] NM_001348064.1:c.171GCA[52] NM_001348064.1:c.171GCA[53] NM_001348064.1:c.171GCA[54] NM_001348064.1:c.171GCA[55] NM_001348064.1:c.171GCA[56] NM_001348064.1:c.171GCA[57] NM_001348064.1:c.171GCA[58] NM_001348064.1:c.171GCA[59]
AR transcript variant 4 NM_001348063.1:c.171_239= NM_001348063.1:c.171GCA[6] NM_001348063.1:c.171GCA[7] NM_001348063.1:c.171GCA[8] NM_001348063.1:c.171GCA[9] NM_001348063.1:c.171GCA[10] NM_001348063.1:c.171GCA[11] NM_001348063.1:c.171GCA[12] NM_001348063.1:c.171GCA[13] NM_001348063.1:c.171GCA[14] NM_001348063.1:c.171GCA[15] NM_001348063.1:c.171GCA[16] NM_001348063.1:c.171GCA[17] NM_001348063.1:c.171GCA[18] NM_001348063.1:c.171GCA[19] NM_001348063.1:c.171GCA[20] NM_001348063.1:c.171GCA[21] NM_001348063.1:c.171GCA[22] NM_001348063.1:c.171GCA[24] NM_001348063.1:c.171GCA[25] NM_001348063.1:c.171GCA[26] NM_001348063.1:c.171GCA[27] NM_001348063.1:c.171GCA[28] NM_001348063.1:c.171GCA[29] NM_001348063.1:c.171GCA[30] NM_001348063.1:c.171GCA[31] NM_001348063.1:c.171GCA[32] NM_001348063.1:c.171GCA[33] NM_001348063.1:c.171GCA[34] NM_001348063.1:c.171GCA[35] NM_001348063.1:c.171GCA[36] NM_001348063.1:c.171GCA[37] NM_001348063.1:c.171GCA[38] NM_001348063.1:c.171GCA[39] NM_001348063.1:c.171GCA[40] NM_001348063.1:c.171GCA[41] NM_001348063.1:c.171GCA[42] NM_001348063.1:c.171GCA[43] NM_001348063.1:c.171GCA[44] NM_001348063.1:c.171GCA[45] NM_001348063.1:c.171GCA[46] NM_001348063.1:c.171GCA[47] NM_001348063.1:c.171GCA[48] NM_001348063.1:c.171GCA[49] NM_001348063.1:c.171GCA[50] NM_001348063.1:c.171GCA[51] NM_001348063.1:c.171GCA[52] NM_001348063.1:c.171GCA[53] NM_001348063.1:c.171GCA[54] NM_001348063.1:c.171GCA[55] NM_001348063.1:c.171GCA[56] NM_001348063.1:c.171GCA[57] NM_001348063.1:c.171GCA[58] NM_001348063.1:c.171GCA[59]
LOC109504725 genomic region NG_052629.1:g.101_169= NG_052629.1:g.101GCA[6] NG_052629.1:g.101GCA[7] NG_052629.1:g.101GCA[8] NG_052629.1:g.101GCA[9] NG_052629.1:g.101GCA[10] NG_052629.1:g.101GCA[11] NG_052629.1:g.101GCA[12] NG_052629.1:g.101GCA[13] NG_052629.1:g.101GCA[14] NG_052629.1:g.101GCA[15] NG_052629.1:g.101GCA[16] NG_052629.1:g.101GCA[17] NG_052629.1:g.101GCA[18] NG_052629.1:g.101GCA[19] NG_052629.1:g.101GCA[20] NG_052629.1:g.101GCA[21] NG_052629.1:g.101GCA[22] NG_052629.1:g.101GCA[24] NG_052629.1:g.101GCA[25] NG_052629.1:g.101GCA[26] NG_052629.1:g.101GCA[27] NG_052629.1:g.101GCA[28] NG_052629.1:g.101GCA[29] NG_052629.1:g.101GCA[30] NG_052629.1:g.101GCA[31] NG_052629.1:g.101GCA[32] NG_052629.1:g.101GCA[33] NG_052629.1:g.101GCA[34] NG_052629.1:g.101GCA[35] NG_052629.1:g.101GCA[36] NG_052629.1:g.101GCA[37] NG_052629.1:g.101GCA[38] NG_052629.1:g.101GCA[39] NG_052629.1:g.101GCA[40] NG_052629.1:g.101GCA[41] NG_052629.1:g.101GCA[42] NG_052629.1:g.101GCA[43] NG_052629.1:g.101GCA[44] NG_052629.1:g.101GCA[45] NG_052629.1:g.101GCA[46] NG_052629.1:g.101GCA[47] NG_052629.1:g.101GCA[48] NG_052629.1:g.101GCA[49] NG_052629.1:g.101GCA[50] NG_052629.1:g.101GCA[51] NG_052629.1:g.101GCA[52] NG_052629.1:g.101GCA[53] NG_052629.1:g.101GCA[54] NG_052629.1:g.101GCA[55] NG_052629.1:g.101GCA[56] NG_052629.1:g.101GCA[57] NG_052629.1:g.101GCA[58] NG_052629.1:g.101GCA[59]
androgen receptor isoform 1 NP_000035.2:p.Leu57_Gln80= NP_000035.2:p.Gln64_Gln80del NP_000035.2:p.Gln65_Gln80del NP_000035.2:p.Gln66_Gln80del NP_000035.2:p.Gln67_Gln80del NP_000035.2:p.Gln68_Gln80del NP_000035.2:p.Gln69_Gln80del NP_000035.2:p.Gln70_Gln80del NP_000035.2:p.Gln71_Gln80del NP_000035.2:p.Gln72_Gln80del NP_000035.2:p.Gln73_Gln80del NP_000035.2:p.Gln74_Gln80del NP_000035.2:p.Gln75_Gln80del NP_000035.2:p.Gln76_Gln80del NP_000035.2:p.Gln77_Gln80del NP_000035.2:p.Gln78_Gln80del NP_000035.2:p.Gln79_Gln80del NP_000035.2:p.Gln80del NP_000035.2:p.Gln80dup NP_000035.2:p.Gln79_Gln80dup NP_000035.2:p.Gln78_Gln80dup NP_000035.2:p.Gln77_Gln80dup NP_000035.2:p.Gln76_Gln80dup NP_000035.2:p.Gln75_Gln80dup NP_000035.2:p.Gln74_Gln80dup NP_000035.2:p.Gln73_Gln80dup NP_000035.2:p.Gln72_Gln80dup NP_000035.2:p.Gln71_Gln80dup NP_000035.2:p.Gln70_Gln80dup NP_000035.2:p.Gln69_Gln80dup NP_000035.2:p.Gln68_Gln80dup NP_000035.2:p.Gln67_Gln80dup NP_000035.2:p.Gln66_Gln80dup NP_000035.2:p.Gln65_Gln80dup NP_000035.2:p.Gln64_Gln80dup NP_000035.2:p.Gln63_Gln80dup NP_000035.2:p.Gln62_Gln80dup NP_000035.2:p.Gln61_Gln80dup NP_000035.2:p.Gln60_Gln80dup NP_000035.2:p.Gln59_Gln80dup NP_000035.2:p.Gln58_Gln80dup NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_000035.2:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln
androgen receptor isoform 3 NP_001334990.1:p.Leu57_Gln80= NP_001334990.1:p.Gln64_Gln80del NP_001334990.1:p.Gln65_Gln80del NP_001334990.1:p.Gln66_Gln80del NP_001334990.1:p.Gln67_Gln80del NP_001334990.1:p.Gln68_Gln80del NP_001334990.1:p.Gln69_Gln80del NP_001334990.1:p.Gln70_Gln80del NP_001334990.1:p.Gln71_Gln80del NP_001334990.1:p.Gln72_Gln80del NP_001334990.1:p.Gln73_Gln80del NP_001334990.1:p.Gln74_Gln80del NP_001334990.1:p.Gln75_Gln80del NP_001334990.1:p.Gln76_Gln80del NP_001334990.1:p.Gln77_Gln80del NP_001334990.1:p.Gln78_Gln80del NP_001334990.1:p.Gln79_Gln80del NP_001334990.1:p.Gln80del NP_001334990.1:p.Gln80dup NP_001334990.1:p.Gln79_Gln80dup NP_001334990.1:p.Gln78_Gln80dup NP_001334990.1:p.Gln77_Gln80dup NP_001334990.1:p.Gln76_Gln80dup NP_001334990.1:p.Gln75_Gln80dup NP_001334990.1:p.Gln74_Gln80dup NP_001334990.1:p.Gln73_Gln80dup NP_001334990.1:p.Gln72_Gln80dup NP_001334990.1:p.Gln71_Gln80dup NP_001334990.1:p.Gln70_Gln80dup NP_001334990.1:p.Gln69_Gln80dup NP_001334990.1:p.Gln68_Gln80dup NP_001334990.1:p.Gln67_Gln80dup NP_001334990.1:p.Gln66_Gln80dup NP_001334990.1:p.Gln65_Gln80dup NP_001334990.1:p.Gln64_Gln80dup NP_001334990.1:p.Gln63_Gln80dup NP_001334990.1:p.Gln62_Gln80dup NP_001334990.1:p.Gln61_Gln80dup NP_001334990.1:p.Gln60_Gln80dup NP_001334990.1:p.Gln59_Gln80dup NP_001334990.1:p.Gln58_Gln80dup NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334990.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln
androgen receptor isoform 5 NP_001334993.1:p.Leu57_Gln80= NP_001334993.1:p.Gln64_Gln80del NP_001334993.1:p.Gln65_Gln80del NP_001334993.1:p.Gln66_Gln80del NP_001334993.1:p.Gln67_Gln80del NP_001334993.1:p.Gln68_Gln80del NP_001334993.1:p.Gln69_Gln80del NP_001334993.1:p.Gln70_Gln80del NP_001334993.1:p.Gln71_Gln80del NP_001334993.1:p.Gln72_Gln80del NP_001334993.1:p.Gln73_Gln80del NP_001334993.1:p.Gln74_Gln80del NP_001334993.1:p.Gln75_Gln80del NP_001334993.1:p.Gln76_Gln80del NP_001334993.1:p.Gln77_Gln80del NP_001334993.1:p.Gln78_Gln80del NP_001334993.1:p.Gln79_Gln80del NP_001334993.1:p.Gln80del NP_001334993.1:p.Gln80dup NP_001334993.1:p.Gln79_Gln80dup NP_001334993.1:p.Gln78_Gln80dup NP_001334993.1:p.Gln77_Gln80dup NP_001334993.1:p.Gln76_Gln80dup NP_001334993.1:p.Gln75_Gln80dup NP_001334993.1:p.Gln74_Gln80dup NP_001334993.1:p.Gln73_Gln80dup NP_001334993.1:p.Gln72_Gln80dup NP_001334993.1:p.Gln71_Gln80dup NP_001334993.1:p.Gln70_Gln80dup NP_001334993.1:p.Gln69_Gln80dup NP_001334993.1:p.Gln68_Gln80dup NP_001334993.1:p.Gln67_Gln80dup NP_001334993.1:p.Gln66_Gln80dup NP_001334993.1:p.Gln65_Gln80dup NP_001334993.1:p.Gln64_Gln80dup NP_001334993.1:p.Gln63_Gln80dup NP_001334993.1:p.Gln62_Gln80dup NP_001334993.1:p.Gln61_Gln80dup NP_001334993.1:p.Gln60_Gln80dup NP_001334993.1:p.Gln59_Gln80dup NP_001334993.1:p.Gln58_Gln80dup NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334993.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln
androgen receptor isoform 4 NP_001334992.1:p.Leu57_Gln80= NP_001334992.1:p.Gln64_Gln80del NP_001334992.1:p.Gln65_Gln80del NP_001334992.1:p.Gln66_Gln80del NP_001334992.1:p.Gln67_Gln80del NP_001334992.1:p.Gln68_Gln80del NP_001334992.1:p.Gln69_Gln80del NP_001334992.1:p.Gln70_Gln80del NP_001334992.1:p.Gln71_Gln80del NP_001334992.1:p.Gln72_Gln80del NP_001334992.1:p.Gln73_Gln80del NP_001334992.1:p.Gln74_Gln80del NP_001334992.1:p.Gln75_Gln80del NP_001334992.1:p.Gln76_Gln80del NP_001334992.1:p.Gln77_Gln80del NP_001334992.1:p.Gln78_Gln80del NP_001334992.1:p.Gln79_Gln80del NP_001334992.1:p.Gln80del NP_001334992.1:p.Gln80dup NP_001334992.1:p.Gln79_Gln80dup NP_001334992.1:p.Gln78_Gln80dup NP_001334992.1:p.Gln77_Gln80dup NP_001334992.1:p.Gln76_Gln80dup NP_001334992.1:p.Gln75_Gln80dup NP_001334992.1:p.Gln74_Gln80dup NP_001334992.1:p.Gln73_Gln80dup NP_001334992.1:p.Gln72_Gln80dup NP_001334992.1:p.Gln71_Gln80dup NP_001334992.1:p.Gln70_Gln80dup NP_001334992.1:p.Gln69_Gln80dup NP_001334992.1:p.Gln68_Gln80dup NP_001334992.1:p.Gln67_Gln80dup NP_001334992.1:p.Gln66_Gln80dup NP_001334992.1:p.Gln65_Gln80dup NP_001334992.1:p.Gln64_Gln80dup NP_001334992.1:p.Gln63_Gln80dup NP_001334992.1:p.Gln62_Gln80dup NP_001334992.1:p.Gln61_Gln80dup NP_001334992.1:p.Gln60_Gln80dup NP_001334992.1:p.Gln59_Gln80dup NP_001334992.1:p.Gln58_Gln80dup NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln NP_001334992.1:p.Glu81_Thr82insGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGlnGln
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

99 SubSNP, 53 Frequency, 23 ClinVar submissions
No Submitter Submission ID Date (Build)
1 TSC-CSHL ss4263404 Jan 05, 2002 (102)
2 TSC-CSHL ss5406161 Oct 12, 2018 (152)
3 REFSEQ ss475659858 Dec 02, 2011 (136)
4 NCBI-CURATED-RECORDS ss1399952663 Oct 10, 2014 (142)
5 EVA_UK10K_ALSPAC ss1709746479 Apr 01, 2015 (136)
6 EVA_UK10K_TWINSUK ss1709746547 Apr 01, 2015 (136)
7 EVA_UK10K_ALSPAC ss1710864201 Apr 01, 2015 (144)
8 EVA_UK10K_TWINSUK ss1710864287 Apr 01, 2015 (144)
9 EVA_EXAC ss1712265011 Apr 01, 2015 (136)
10 EVA_EXAC ss1712265012 Apr 01, 2015 (144)
11 EVA_EXAC ss1712265013 Apr 01, 2015 (136)
12 EVA_EXAC ss1712265014 Apr 01, 2015 (144)
13 EVA_EXAC ss1712265015 Apr 01, 2015 (144)
14 EVA_EXAC ss1712265016 Apr 01, 2015 (144)
15 CLINVAR ss1939867210 Oct 20, 2015 (146)
16 CLINVAR ss2019492178 Jul 28, 2016 (147)
17 CLINVAR ss2136852460 Dec 04, 2016 (149)
18 CLINVAR ss2137520549 May 31, 2017 (150)
19 CLINVAR ss2137521084 May 31, 2017 (150)
20 CLINVAR ss2137522124 May 31, 2017 (150)
21 CLINVAR ss2137523911 May 31, 2017 (150)
22 SWEGEN ss3020089624 Nov 08, 2017 (151)
23 MCHAISSO ss3065264330 Nov 08, 2017 (151)
24 MCHAISSO ss3066292438 Nov 08, 2017 (151)
25 TOPMED ss3613064110 Nov 08, 2017 (151)
26 TOPMED ss3613064111 Nov 08, 2017 (151)
27 TOPMED ss3613064112 Nov 08, 2017 (151)
28 TOPMED ss3613064113 Nov 08, 2017 (151)
29 TOPMED ss3613064114 Nov 08, 2017 (151)
30 TOPMED ss3613064115 Nov 08, 2017 (151)
31 TOPMED ss3613064120 Nov 08, 2017 (151)
32 TOPMED ss3613064121 Nov 08, 2017 (151)
33 TOPMED ss3613064122 Nov 08, 2017 (151)
34 TOPMED ss3613064123 Nov 08, 2017 (151)
35 TOPMED ss3613064124 Nov 08, 2017 (151)
36 TOPMED ss3613064125 Nov 08, 2017 (151)
37 TOPMED ss3613064126 Nov 08, 2017 (151)
38 TOPMED ss3613064127 Nov 08, 2017 (151)
39 TOPMED ss3613064128 Nov 08, 2017 (151)
40 TOPMED ss3613064129 Nov 08, 2017 (151)
41 TOPMED ss3613064130 Nov 08, 2017 (151)
42 TOPMED ss3613064131 Nov 08, 2017 (151)
43 TOPMED ss3613064132 Nov 08, 2017 (151)
44 TOPMED ss3613064133 Nov 08, 2017 (151)
45 TOPMED ss3613064134 Nov 08, 2017 (151)
46 TOPMED ss3613064135 Nov 08, 2017 (151)
47 PACBIO ss3788906974 Jul 13, 2019 (153)
48 PACBIO ss3793772005 Jul 13, 2019 (153)
49 PACBIO ss3793772006 Jul 13, 2019 (153)
50 PACBIO ss3798657189 Jul 13, 2019 (153)
51 PACBIO ss3798657190 Jul 13, 2019 (153)
52 EVA ss3836189299 Apr 27, 2020 (154)
53 FSA-LAB ss3984441548 Apr 26, 2021 (155)
54 FSA-LAB ss3984441549 Apr 26, 2021 (155)
55 GNOMAD ss4372947207 Apr 26, 2021 (155)
56 GNOMAD ss4372947208 Apr 26, 2021 (155)
57 GNOMAD ss4372947209 Apr 26, 2021 (155)
58 GNOMAD ss4372947210 Apr 26, 2021 (155)
59 GNOMAD ss4372947211 Apr 26, 2021 (155)
60 GNOMAD ss4372947212 Apr 26, 2021 (155)
61 GNOMAD ss4372947213 Apr 26, 2021 (155)
62 GNOMAD ss4372947214 Apr 26, 2021 (155)
63 GNOMAD ss4372947215 Apr 26, 2021 (155)
64 GNOMAD ss4372947216 Apr 26, 2021 (155)
65 GNOMAD ss4372947217 Apr 26, 2021 (155)
66 GNOMAD ss4372947218 Apr 26, 2021 (155)
67 GNOMAD ss4372947219 Apr 26, 2021 (155)
68 GNOMAD ss4372947220 Apr 26, 2021 (155)
69 GNOMAD ss4372947221 Apr 26, 2021 (155)
70 GNOMAD ss4372947222 Apr 26, 2021 (155)
71 GNOMAD ss4372947229 Apr 26, 2021 (155)
72 GNOMAD ss4372947230 Apr 26, 2021 (155)
73 GNOMAD ss4372947231 Apr 26, 2021 (155)
74 GNOMAD ss4372947232 Apr 26, 2021 (155)
75 GNOMAD ss4372947233 Apr 26, 2021 (155)
76 GNOMAD ss4372947234 Apr 26, 2021 (155)
77 GNOMAD ss4372947235 Apr 26, 2021 (155)
78 GNOMAD ss4372947236 Apr 26, 2021 (155)
79 GNOMAD ss4372947237 Apr 26, 2021 (155)
80 GNOMAD ss4372947238 Apr 26, 2021 (155)
81 GNOMAD ss4372947239 Apr 26, 2021 (155)
82 GNOMAD ss4372947240 Apr 26, 2021 (155)
83 GNOMAD ss4372947241 Apr 26, 2021 (155)
84 GNOMAD ss4372947242 Apr 26, 2021 (155)
85 GNOMAD ss4372947243 Apr 26, 2021 (155)
86 GNOMAD ss4372947244 Apr 26, 2021 (155)
87 TOPMED ss5125495753 Apr 26, 2021 (155)
88 TOMMO_GENOMICS ss5234784632 Apr 26, 2021 (155)
89 TOMMO_GENOMICS ss5234784633 Apr 26, 2021 (155)
90 TOMMO_GENOMICS ss5234784634 Apr 26, 2021 (155)
91 TOMMO_GENOMICS ss5234784635 Apr 26, 2021 (155)
92 TOMMO_GENOMICS