Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.


Current Build 155

Released April 9, 2021

Homo sapiens
chr10:94298327-94298351 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Variation Type
Indel Insertion and Deletion
delATTTAAAG(T)4CTACACTAAT=0.000004 (1/264690, TOPMED)
delATTTAAAG(T)4CTACACTAAT=0.00000 (0/10680, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
PLCE1 : Intron Variant
0 citations
Genomic View
See rs on genome

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 10 NC_000010.11:g.94298330_94298351del
GRCh37.p13 chr 10 NC_000010.10:g.96058087_96058108del
PLCE1 RefSeqGene NG_015799.1:g.309342_309363del
Gene: PLCE1, phospholipase C epsilon 1 (plus strand)
Molecule type Change Amino acid[Codon] SO Term
PLCE1 transcript variant 2 NM_001165979.2:c.4244-49_…


N/A Intron Variant
PLCE1 transcript variant 3 NM_001288989.2:c.5120-49_…


N/A Intron Variant
PLCE1 transcript variant 1 NM_016341.4:c.5168-49_516…


N/A Intron Variant
PLCE1 transcript variant X1 XM_006717885.4:c.5210-49_…


N/A Intron Variant
PLCE1 transcript variant X5 XM_006717888.4:c.5207-49_…


N/A Intron Variant
PLCE1 transcript variant X6 XM_006717889.4:c.5162-49_…


N/A Intron Variant
PLCE1 transcript variant X7 XM_006717890.3:c.4286-49_…


N/A Intron Variant
PLCE1 transcript variant X2 XM_011539849.3:c.5210-49_…


N/A Intron Variant
PLCE1 transcript variant X9 XM_011539850.3:c.4055-49_…


N/A Intron Variant
PLCE1 transcript variant X3 XM_017016310.2:c.5210-49_…


N/A Intron Variant
PLCE1 transcript variant X4 XM_017016311.2:c.5210-49_…


N/A Intron Variant
PLCE1 transcript variant X8 XM_017016312.2:c.4196-49_…


N/A Intron Variant
PLCE1 transcript variant X10 XM_011539851.3:c. N/A Genic Downstream Transcript Variant
PLCE1 transcript variant X11 XM_011539852.3:c. N/A Genic Downstream Transcript Variant

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 10680 AATATTTAAAGTTTTCTACACTAAT=1.00000 AAT=0.00000
European Sub 6962 AATATTTAAAGTTTTCTACACTAAT=1.0000 AAT=0.0000
African Sub 2294 AATATTTAAAGTTTTCTACACTAAT=1.0000 AAT=0.0000
African American Sub 2210 AATATTTAAAGTTTTCTACACTAAT=1.0000 AAT=0.0000
Latin American 1 Sub 146 AATATTTAAAGTTTTCTACACTAAT=1.000 AAT=0.000
Latin American 2 Sub 610 AATATTTAAAGTTTTCTACACTAAT=1.000 AAT=0.000


Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 AATATTTAAAG(T)4CTACACTAAT=0.999996 delATTTAAAG(T)4CTACACTAAT=0.000004

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

GRCh38.p13 chr 10 NC_000010.11:g.94298327_94298351= NC_000010.11:g.94298330_94298351del
GRCh37.p13 chr 10 NC_000010.10:g.96058084_96058108= NC_000010.10:g.96058087_96058108del
PLCE1 RefSeqGene NG_015799.1:g.309339_309363= NG_015799.1:g.309342_309363del
PLCE1 transcript variant 2 NM_001165979.1:c.4244-52= NM_001165979.1:c.4244-49_4244-28del
PLCE1 transcript variant 2 NM_001165979.2:c.4244-52= NM_001165979.2:c.4244-49_4244-28del
PLCE1 transcript variant 3 NM_001288989.2:c.5120-52= NM_001288989.2:c.5120-49_5120-28del
PLCE1 transcript variant 1 NM_016341.3:c.5168-52= NM_016341.3:c.5168-49_5168-28del
PLCE1 transcript variant 1 NM_016341.4:c.5168-52= NM_016341.4:c.5168-49_5168-28del
PLCE1 transcript variant X1 XM_005269880.1:c.5168-52= XM_005269880.1:c.5168-49_5168-28del
PLCE1 transcript variant X2 XM_005269881.1:c.5120-52= XM_005269881.1:c.5120-49_5120-28del
PLCE1 transcript variant X3 XM_005269882.1:c.2333-52= XM_005269882.1:c.2333-49_2333-28del
PLCE1 transcript variant X1 XM_006717885.4:c.5210-52= XM_006717885.4:c.5210-49_5210-28del
PLCE1 transcript variant X5 XM_006717888.4:c.5207-52= XM_006717888.4:c.5207-49_5207-28del
PLCE1 transcript variant X6 XM_006717889.4:c.5162-52= XM_006717889.4:c.5162-49_5162-28del
PLCE1 transcript variant X7 XM_006717890.3:c.4286-52= XM_006717890.3:c.4286-49_4286-28del
PLCE1 transcript variant X2 XM_011539849.3:c.5210-52= XM_011539849.3:c.5210-49_5210-28del
PLCE1 transcript variant X9 XM_011539850.3:c.4055-52= XM_011539850.3:c.4055-49_4055-28del
PLCE1 transcript variant X3 XM_017016310.2:c.5210-52= XM_017016310.2:c.5210-49_5210-28del
PLCE1 transcript variant X4 XM_017016311.2:c.5210-52= XM_017016311.2:c.5210-49_5210-28del
PLCE1 transcript variant X8 XM_017016312.2:c.4196-52= XM_017016312.2:c.4196-49_4196-28del

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

1 SubSNP, 2 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOPMED ss4862508964 Apr 27, 2021 (155)
2 TopMed NC_000010.11 - 94298327 Apr 27, 2021 (155)
3 ALFA NC_000010.11 - 94298327 Apr 27, 2021 (155)

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
78054619, ss4862508964 NC_000010.11:94298326:AATATTTAAAGT…




11947093796 NC_000010.11:94298326:AATATTTAAAGT…





Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs2052913496


The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad