Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs200275128

Current Build 155

Released April 9, 2021

Organism
Homo sapiens
Position
chr22:38982239-38982262 (GRCh38.p13) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
del(CCAGAG)2 / delCCAGAG / dupCCAG…

del(CCAGAG)2 / delCCAGAG / dupCCAGAG

Variation Type
Indel Insertion and Deletion
Frequency
delCCAGAG=0.000019 (5/264690, TOPMED)
dupCCAGAG=0.00005 (1/18290, ALFA)
dupCCAGAG=0.00090 (14/15604, 8.3KJPN) (+ 1 more)
dupCCAGAG=0.0024 (4/1698, Korea1K)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
APOBEC3B : 2KB Upstream Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p13 chr 22 NC_000022.11:g.38982239CCAGAG[2]
GRCh38.p13 chr 22 NC_000022.11:g.38982239CCAGAG[3]
GRCh38.p13 chr 22 NC_000022.11:g.38982239CCAGAG[5]
GRCh37.p13 chr 22 NC_000022.10:g.39378244CCAGAG[2]
GRCh37.p13 chr 22 NC_000022.10:g.39378244CCAGAG[3]
GRCh37.p13 chr 22 NC_000022.10:g.39378244CCAGAG[5]
Gene: APOBEC3B, apolipoprotein B mRNA editing enzyme catalytic subunit 3B (plus strand) : 2KB Upstream Variant
Molecule type Change Amino acid[Codon] SO Term
APOBEC3B transcript variant 2 NM_001270411.2:c. N/A Upstream Transcript Variant
APOBEC3B transcript variant 1 NM_004900.5:c. N/A Upstream Transcript Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20201027095038
Population Group Sample Size Ref Allele Alt Allele
Total Global 18290 CCAGAGCCAGAGCCAGAGCCAGAG=0.99995 CCAGAGCCAGAG=0.00000, CCAGAGCCAGAGCCAGAG=0.00000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.00005
European Sub 14128 CCAGAGCCAGAGCCAGAGCCAGAG=0.99993 CCAGAGCCAGAG=0.00000, CCAGAGCCAGAGCCAGAG=0.00000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.00007
African Sub 2704 CCAGAGCCAGAGCCAGAGCCAGAG=1.0000 CCAGAGCCAGAG=0.0000, CCAGAGCCAGAGCCAGAG=0.0000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.0000
African Others Sub 106 CCAGAGCCAGAGCCAGAGCCAGAG=1.000 CCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.000
African American Sub 2598 CCAGAGCCAGAGCCAGAGCCAGAG=1.0000 CCAGAGCCAGAG=0.0000, CCAGAGCCAGAGCCAGAG=0.0000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.0000
Asian Sub 112 CCAGAGCCAGAGCCAGAGCCAGAG=1.000 CCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.000
East Asian Sub 86 CCAGAGCCAGAGCCAGAGCCAGAG=1.00 CCAGAGCCAGAG=0.00, CCAGAGCCAGAGCCAGAG=0.00, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.00
Other Asian Sub 26 CCAGAGCCAGAGCCAGAGCCAGAG=1.00 CCAGAGCCAGAG=0.00, CCAGAGCCAGAGCCAGAG=0.00, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.00
Latin American 1 Sub 142 CCAGAGCCAGAGCCAGAGCCAGAG=1.000 CCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.000
Latin American 2 Sub 608 CCAGAGCCAGAGCCAGAGCCAGAG=1.000 CCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.000
South Asian Sub 98 CCAGAGCCAGAGCCAGAGCCAGAG=1.00 CCAGAGCCAGAG=0.00, CCAGAGCCAGAGCCAGAG=0.00, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.00
Other Sub 498 CCAGAGCCAGAGCCAGAGCCAGAG=1.000 CCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAG=0.000, CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 (CCAGAG)4=0.999981 delCCAGAG=0.000019
Allele Frequency Aggregator Total Global 18290 (CCAGAG)4=0.99995 del(CCAGAG)2=0.00000, delCCAGAG=0.00000, dupCCAGAG=0.00005
Allele Frequency Aggregator European Sub 14128 (CCAGAG)4=0.99993 del(CCAGAG)2=0.00000, delCCAGAG=0.00000, dupCCAGAG=0.00007
Allele Frequency Aggregator African Sub 2704 (CCAGAG)4=1.0000 del(CCAGAG)2=0.0000, delCCAGAG=0.0000, dupCCAGAG=0.0000
Allele Frequency Aggregator Latin American 2 Sub 608 (CCAGAG)4=1.000 del(CCAGAG)2=0.000, delCCAGAG=0.000, dupCCAGAG=0.000
Allele Frequency Aggregator Other Sub 498 (CCAGAG)4=1.000 del(CCAGAG)2=0.000, delCCAGAG=0.000, dupCCAGAG=0.000
Allele Frequency Aggregator Latin American 1 Sub 142 (CCAGAG)4=1.000 del(CCAGAG)2=0.000, delCCAGAG=0.000, dupCCAGAG=0.000
Allele Frequency Aggregator Asian Sub 112 (CCAGAG)4=1.000 del(CCAGAG)2=0.000, delCCAGAG=0.000, dupCCAGAG=0.000
Allele Frequency Aggregator South Asian Sub 98 (CCAGAG)4=1.00 del(CCAGAG)2=0.00, delCCAGAG=0.00, dupCCAGAG=0.00
8.3KJPN JAPANESE Study-wide 15604 -

No frequency provided

dupCCAGAG=0.00090
Korean Genome Project KOREAN Study-wide 1698 -

No frequency provided

dupCCAGAG=0.0024
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement (CCAGAG)4= del(CCAGAG)2 delCCAGAG dupCCAGAG
GRCh38.p13 chr 22 NC_000022.11:g.38982239_38982262= NC_000022.11:g.38982239CCAGAG[2] NC_000022.11:g.38982239CCAGAG[3] NC_000022.11:g.38982239CCAGAG[5]
GRCh37.p13 chr 22 NC_000022.10:g.39378244_39378267= NC_000022.10:g.39378244CCAGAG[2] NC_000022.10:g.39378244CCAGAG[3] NC_000022.10:g.39378244CCAGAG[5]
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

13 SubSNP, 7 Frequency submissions
No Submitter Submission ID Date (Build)
1 1000GENOMES ss499875664 May 04, 2012 (137)
2 TOPMED ss2414476171 Dec 20, 2016 (150)
3 TOPMED ss3377726339 Nov 08, 2017 (151)
4 TOPMED ss3377726340 Nov 08, 2017 (151)
5 TOPMED ss3377726341 Nov 08, 2017 (151)
6 EVA_DECODE ss3708244115 Jul 13, 2019 (153)
7 KOGIC ss3983685271 Apr 27, 2020 (154)
8 EVA ss3986864356 Apr 26, 2021 (155)
9 GNOMAD ss4364960873 Apr 26, 2021 (155)
10 GNOMAD ss4364960874 Apr 26, 2021 (155)
11 GNOMAD ss4364960875 Apr 26, 2021 (155)
12 TOPMED ss5109957609 Apr 26, 2021 (155)
13 TOMMO_GENOMICS ss5232727094 Apr 26, 2021 (155)
14 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 570586987 (NC_000022.11:38982238::CCAGAG 1630/137402)
Row 570586988 (NC_000022.11:38982238:CCAGAG: 3/137406)
Row 570586989 (NC_000022.11:38982238:CCAGAGCCAGAG: 12/137406)

- Apr 26, 2021 (155)
15 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 570586987 (NC_000022.11:38982238::CCAGAG 1630/137402)
Row 570586988 (NC_000022.11:38982238:CCAGAG: 3/137406)
Row 570586989 (NC_000022.11:38982238:CCAGAGCCAGAG: 12/137406)

- Apr 26, 2021 (155)
16 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 570586987 (NC_000022.11:38982238::CCAGAG 1630/137402)
Row 570586988 (NC_000022.11:38982238:CCAGAG: 3/137406)
Row 570586989 (NC_000022.11:38982238:CCAGAGCCAGAG: 12/137406)

- Apr 26, 2021 (155)
17 Korean Genome Project NC_000022.11 - 38982239 Apr 27, 2020 (154)
18 8.3KJPN NC_000022.10 - 39378244 Apr 26, 2021 (155)
19 TopMed NC_000022.11 - 38982239 Apr 26, 2021 (155)
20 ALFA NC_000022.11 - 38982239 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
240535723, ss3377726341, ss4364960875 NC_000022.11:38982238:CCAGAGCCAGAG: NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAG

(self)
247751506 NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAG

NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAG

(self)
ss2414476171 NC_000022.10:39378243:CCAGAG: NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAG

(self)
385066556, ss3377726340, ss4364960874, ss5109957609 NC_000022.11:38982238:CCAGAG: NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAG

(self)
247751506 NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAG

NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAG

90696401, ss499875664, ss3986864356, ss5232727094 NC_000022.10:39378243::CCAGAG NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG

(self)
40063272, ss3377726339, ss3708244115, ss3983685271, ss4364960873 NC_000022.11:38982238::CCAGAG NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG

(self)
247751506 NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG

NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAGCCAGAGCCAGAGCCAGAG

Removed from this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Destination RSIDs
NC_000022.10:39378243:CCAGAGCCAGAG: NC_000022.11:38982238:CCAGAGCCAGAG…

NC_000022.11:38982238:CCAGAGCCAGAGCCAGAGCCAGAG:CCAGAGCCAGAG

Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs200275128

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post596+ae089ad