Skip to main page content

dbSNP Short Genetic Variations

Reference SNP (rs) Report


This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.


Current Build 152

Released October 2, 2018

Homo sapiens
chrX:108620290-108620322 (GRCh38.p7) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Variation Type
Indel Insertion and Deletion
Clinical Significance
Reported in ClinVar
Gene : Consequence
COL4A5 : Inframe Deletion
1 citation
Genomic View
See rs on genome

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p7 chr X NC_000023.11:g.108620299_108620322del
GRCh37.p13 chr X NC_000023.10:g.107863529_107863552del
COL4A5 RefSeqGene NG_011977.1:g.185376_185399del

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Allele: delTCCTGGACTTGATGTTCCAGGACC (allele ID: 35876 )
ClinVar Accession Disease Names Clinical Significance
RCV000021414.1 Alport syndrome, X-linked recessive Pathogenic

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").


Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement TCCAGGA(CCT)2




GRCh38.p7 chr X NC_000023.11:g.10862029...




GRCh37.p13 chr X NC_000023.10:g.10786352...




COL4A5 RefSeqGene NG_011977.1:g.185367_18...




COL4A5 transcript variant 1 NM_000495.4:c.2541_2573= NM_000495.4:c.2550_2573del
COL4A5 transcript variant 2 NM_033380.2:c.2541_2573= NM_033380.2:c.2550_2573del
COL4A5 transcript variant X1 XM_011530849.2:c.2556_2...




COL4A5 transcript variant X3 XM_017029260.1:c.2556_2...




COL4A5 transcript variant X2 XM_017029259.1:c.2556_2...




COL4A5 transcript variant X6 XM_017029263.1:c.876_908= XM_017029263.1:c.885_90...


COL4A5 transcript variant X4 XM_017029261.1:c.2556_2...




COL4A5 transcript variant X5 XM_017029262.1:c.2556_2...




collagen alpha-5(IV) chain isoform 1 precursor NP_000486.1:p.Asp847_Pr...




collagen alpha-5(IV) chain isoform 2 precursor NP_203699.1:p.Asp847_Pr...




collagen alpha-5(IV) chain isoform X1 XP_011529151.2:p.Asp852...




collagen alpha-5(IV) chain isoform X3 XP_016884749.1:p.Asp852...




collagen alpha-5(IV) chain isoform X2 XP_016884748.1:p.Asp852...




collagen alpha-5(IV) chain isoform X6 XP_016884752.1:p.Asp292...




collagen alpha-5(IV) chain isoform X4 XP_016884750.1:p.Asp852...




collagen alpha-5(IV) chain isoform X5 XP_016884751.1:p.Asp852...





Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

1 SubSNP, 1 ClinVar submissions
No Submitter Submission ID Date (Build)
1 ARUP_COL4A5 ss244223524 May 07, 2010 (132)
2 ClinVar RCV000021414.1 Jul 20, 2018 (151)

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission ids Observation SPDI Canonical SPDI Source RSIDs
RCV000021414.1, ss244223524 NC_000023.11:108620298:delTCCTGGAC…





Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

1 citation for rs104886359
PMID Title Author Year Journal
15780079 Detection of mutations in the COL4A5 gene by analyzing cDNA of skin fibroblasts. Wang F et al. 2005 Kidney international

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 0.1.4.post863+3a64c51