Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 56

1.

rs6003 [Homo sapiens]
    TTGTATAAAATTCAAGAGAACATGC[A/G]TTATGGTTGCGCTTCAGGGTACAAA
    Chromosome:
    1:197061891
    Gene:
    F13B (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.2382/1193
    HGVS:
    NC_000001.10:g.197031021C>T, NC_000001.11:g.197061891C>T, NG_012065.1:g.10377G>A, NM_001994.2:c.344G>A, NP_001985.2:p.Arg115His, XM_005244953.1:c.344G>A, XM_005244954.1:c.266-18G>A, XM_005244955.1:c.122-18G>A, XM_011509283.2:c.344G>A, XM_011509284.2:c.344G>A, XM_011509286.2:c.200G>A, XP_005245010.1:p.Arg115His, XP_011507585.1:p.Arg115His, XP_011507586.1:p.Arg115His, XP_011507588.1:p.Arg67His
    2.

    rs6048 [Homo sapiens]
      AACTTCTAAGCTCACCCGTGCTGAG[A/G]CTGTTTTTCCTGATGTGGACTATGT
      Chromosome:
      X:139551121
      Gene:
      F9 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      other
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      G=0.1457/550
      HGVS:
      NC_000023.10:g.138633280A>G, NC_000023.11:g.139551121A>G, NG_007994.1:g.25386A>G, NM_000133.3:c.580A>G, NM_001313913.1:c.466A>G, NP_000124.1:p.Thr194Ala, NP_001300842.1:p.Thr156Ala, XM_005262396.1:c.466A>G, XM_005262397.1:c.451A>G, XM_005262397.4:c.451A>G, XP_005262453.1:p.Thr156Ala, XP_005262454.1:p.Thr151Ala
      3.

      rs6050 [Homo sapiens]
        ACCTGGGAGCTCTGGACCTGGAAGT[A/G/T]CTGGAAGCTGGAACTCTGGGAGCTC
        Chromosome:
        4:154586438
        Gene:
        FGA (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        other
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        C=0.3271/1638
        HGVS:
        NC_000004.11:g.155507590T>C, NC_000004.12:g.154586438T>C, NG_008832.1:g.9308A>G, NM_000508.3:c.991A>G, NM_000508.4:c.991A>G, NM_021871.2:c.991A>G, NM_021871.3:c.991A>G, NP_000499.1:p.Thr331Ala, NP_068657.1:p.Thr331Ala
        4.

        rs28940297 [Homo sapiens]
          GTGTATACTCTGAAAGAGCGATGCC[C/T]CCAGGTTGTCCGGAGCCTAGTCAAG
          Chromosome:
          3:10149811
          Gene:
          VHL (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          T(germline)/C(germline)
          Clinical significance:
          Pathogenic
          Validated:
          no info
          HGVS:
          NC_000003.11:g.10191495T>C, NC_000003.12:g.10149811T>C, NG_008212.3:g.13177T>C, NM_000551.3:c.488T>C, NM_198156.2:c.365T>C, NP_000542.1:p.Leu163Pro, NP_937799.1:p.Leu122Pro
          5.

          rs28929469 [Homo sapiens]
            TCCCATGAATCCCATGTGCATTTAC[C/T]GCTCCCCGGAGAAGAAGGCAACTGA
            Chromosome:
            1:173914795
            Gene:
            SERPINC1 (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            T(germline)/C(germline)
            Clinical significance:
            Pathogenic
            Validated:
            by cluster,by frequency
            HGVS:
            NC_000001.10:g.173883933G>A, NC_000001.11:g.173914795G>A, NG_012462.1:g.7584C>T, NM_000488.3:c.166C>T, NP_000479.1:p.Arg56Cys, XM_005245198.1:c.22C>T, XM_005245198.3:c.22C>T, XP_005245255.1:p.Arg8Cys
            6.

            rs61754487 [Homo sapiens]
              TGTACCTGGTTTTCATGTTTCTGAG[C/T]CATGTCTCCACCAAGTCTGTGGTCA
              Chromosome:
              14:94288306
              Gene:
              SERPINA10 (GeneView)
              Functional Consequence:
              stop gained
              Allele Origin:
              T(germline)/C(germline)
              Clinical significance:
              Uncertain significance
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              T=0.0014/7
              HGVS:
              NC_000014.8:g.94754643C>T, NC_000014.9:g.94288306C>T, NG_021202.2:g.9954G>A, NM_001100607.2:c.972G>A, NM_016186.2:c.972G>A, NP_001094077.1:p.Trp324Ter, NP_057270.1:p.Trp324Ter, NT_187601.1:g.1402868C>T, XM_005267733.1:c.972G>A, XM_005267733.4:c.972G>A, XM_017021353.1:c.1092G>A, XP_005267790.1:p.Trp324Ter, XP_016876842.1:p.Trp364Ter
              7.

              rs2070019 has merged into rs6050 [Homo sapiens]
                ACCTGGGAGCTCTGGACCTGGAAGT[A/G/T]CTGGAAGCTGGAACTCTGGGAGCTC
                Chromosome:
                4:154586438
                Gene:
                FGA (GeneView)
                Functional Consequence:
                missense
                Allele Origin:
                G(germline)/A(germline)
                Clinical significance:
                other
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                C=0.3271/1638
                HGVS:
                NC_000004.11:g.155507590T>C, NC_000004.12:g.154586438T>C, NG_008832.1:g.9308A>G, NM_000508.3:c.991A>G, NM_000508.4:c.991A>G, NM_021871.2:c.991A>G, NM_021871.3:c.991A>G, NP_000499.1:p.Thr331Ala, NP_068657.1:p.Thr331Ala
                8.

                rs2236789 has merged into rs6050 [Homo sapiens]
                  ACCTGGGAGCTCTGGACCTGGAAGT[A/G/T]CTGGAAGCTGGAACTCTGGGAGCTC
                  Chromosome:
                  4:154586438
                  Gene:
                  FGA (GeneView)
                  Functional Consequence:
                  missense
                  Allele Origin:
                  G(germline)/A(germline)
                  Clinical significance:
                  other
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  C=0.3271/1638
                  HGVS:
                  NC_000004.11:g.155507590T>C, NC_000004.12:g.154586438T>C, NG_008832.1:g.9308A>G, NM_000508.3:c.991A>G, NM_000508.4:c.991A>G, NM_021871.2:c.991A>G, NM_021871.3:c.991A>G, NP_000499.1:p.Thr331Ala, NP_068657.1:p.Thr331Ala
                  9.

                  rs3181844 has merged into rs6048 [Homo sapiens]
                    AACTTCTAAGCTCACCCGTGCTGAG[A/G]CTGTTTTTCCTGATGTGGACTATGT
                    Chromosome:
                    X:139551121
                    Gene:
                    F9 (GeneView)
                    Functional Consequence:
                    missense
                    Allele Origin:
                    G(germline)/A(germline)
                    Clinical significance:
                    other
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    G=0.1457/550
                    HGVS:
                    NC_000023.10:g.138633280A>G, NC_000023.11:g.139551121A>G, NG_007994.1:g.25386A>G, NM_000133.3:c.580A>G, NM_001313913.1:c.466A>G, NP_000124.1:p.Thr194Ala, NP_001300842.1:p.Thr156Ala, XM_005262396.1:c.466A>G, XM_005262397.1:c.451A>G, XM_005262397.4:c.451A>G, XP_005262453.1:p.Thr156Ala, XP_005262454.1:p.Thr151Ala
                    10.

                    rs17514246 has merged into rs6003 [Homo sapiens]
                      TTGTATAAAATTCAAGAGAACATGC[A/G]TTATGGTTGCGCTTCAGGGTACAAA
                      Chromosome:
                      1:197061891
                      Gene:
                      F13B (GeneView)
                      Functional Consequence:
                      missense
                      Allele Origin:
                      G(germline)/A(germline)
                      Clinical significance:
                      other
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      C=0.2382/1193
                      HGVS:
                      NC_000001.10:g.197031021C>T, NC_000001.11:g.197061891C>T, NG_012065.1:g.10377G>A, NM_001994.2:c.344G>A, NP_001985.2:p.Arg115His, XM_005244953.1:c.344G>A, XM_005244954.1:c.266-18G>A, XM_005244955.1:c.122-18G>A, XM_011509283.2:c.344G>A, XM_011509284.2:c.344G>A, XM_011509286.2:c.200G>A, XP_005245010.1:p.Arg115His, XP_011507585.1:p.Arg115His, XP_011507586.1:p.Arg115His, XP_011507588.1:p.Arg67His
                      11.

                      rs52802349 has merged into rs6048 [Homo sapiens]
                        AACTTCTAAGCTCACCCGTGCTGAG[A/G]CTGTTTTTCCTGATGTGGACTATGT
                        Chromosome:
                        X:139551121
                        Gene:
                        F9 (GeneView)
                        Functional Consequence:
                        missense
                        Allele Origin:
                        G(germline)/A(germline)
                        Clinical significance:
                        other
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        G=0.1457/550
                        HGVS:
                        NC_000023.10:g.138633280A>G, NC_000023.11:g.139551121A>G, NG_007994.1:g.25386A>G, NM_000133.3:c.580A>G, NM_001313913.1:c.466A>G, NP_000124.1:p.Thr194Ala, NP_001300842.1:p.Thr156Ala, XM_005262396.1:c.466A>G, XM_005262397.1:c.451A>G, XM_005262397.4:c.451A>G, XP_005262453.1:p.Thr156Ala, XP_005262454.1:p.Thr151Ala
                        12.

                        rs52827096 has merged into rs6003 [Homo sapiens]
                          TTGTATAAAATTCAAGAGAACATGC[A/G]TTATGGTTGCGCTTCAGGGTACAAA
                          Chromosome:
                          1:197061891
                          Gene:
                          F13B (GeneView)
                          Functional Consequence:
                          missense
                          Allele Origin:
                          G(germline)/A(germline)
                          Clinical significance:
                          other
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          C=0.2382/1193
                          HGVS:
                          NC_000001.10:g.197031021C>T, NC_000001.11:g.197061891C>T, NG_012065.1:g.10377G>A, NM_001994.2:c.344G>A, NP_001985.2:p.Arg115His, XM_005244953.1:c.344G>A, XM_005244954.1:c.266-18G>A, XM_005244955.1:c.122-18G>A, XM_011509283.2:c.344G>A, XM_011509284.2:c.344G>A, XM_011509286.2:c.200G>A, XP_005245010.1:p.Arg115His, XP_011507585.1:p.Arg115His, XP_011507586.1:p.Arg115His, XP_011507588.1:p.Arg67His
                          13.

                          rs56492214 has merged into rs6050 [Homo sapiens]
                            ACCTGGGAGCTCTGGACCTGGAAGT[A/G/T]CTGGAAGCTGGAACTCTGGGAGCTC
                            Chromosome:
                            4:154586438
                            Gene:
                            FGA (GeneView)
                            Functional Consequence:
                            missense
                            Allele Origin:
                            G(germline)/A(germline)
                            Clinical significance:
                            other
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            C=0.3271/1638
                            HGVS:
                            NC_000004.11:g.155507590T>C, NC_000004.12:g.154586438T>C, NG_008832.1:g.9308A>G, NM_000508.3:c.991A>G, NM_000508.4:c.991A>G, NM_021871.2:c.991A>G, NM_021871.3:c.991A>G, NP_000499.1:p.Thr331Ala, NP_068657.1:p.Thr331Ala
                            14.

                            rs57668839 has merged into rs6003 [Homo sapiens]
                              TTGTATAAAATTCAAGAGAACATGC[A/G]TTATGGTTGCGCTTCAGGGTACAAA
                              Chromosome:
                              1:197061891
                              Gene:
                              F13B (GeneView)
                              Functional Consequence:
                              missense
                              Allele Origin:
                              G(germline)/A(germline)
                              Clinical significance:
                              other
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              C=0.2382/1193
                              HGVS:
                              NC_000001.10:g.197031021C>T, NC_000001.11:g.197061891C>T, NG_012065.1:g.10377G>A, NM_001994.2:c.344G>A, NP_001985.2:p.Arg115His, XM_005244953.1:c.344G>A, XM_005244954.1:c.266-18G>A, XM_005244955.1:c.122-18G>A, XM_011509283.2:c.344G>A, XM_011509284.2:c.344G>A, XM_011509286.2:c.200G>A, XP_005245010.1:p.Arg115His, XP_011507585.1:p.Arg115His, XP_011507586.1:p.Arg115His, XP_011507588.1:p.Arg67His
                              15.

                              rs59606308 has merged into rs6048 [Homo sapiens]
                                AACTTCTAAGCTCACCCGTGCTGAG[A/G]CTGTTTTTCCTGATGTGGACTATGT
                                Chromosome:
                                X:139551121
                                Gene:
                                F9 (GeneView)
                                Functional Consequence:
                                missense
                                Allele Origin:
                                G(germline)/A(germline)
                                Clinical significance:
                                other
                                Validated:
                                by 1000G,by cluster,by frequency,by hapmap,by submitter
                                Global MAF:
                                G=0.1457/550
                                HGVS:
                                NC_000023.10:g.138633280A>G, NC_000023.11:g.139551121A>G, NG_007994.1:g.25386A>G, NM_000133.3:c.580A>G, NM_001313913.1:c.466A>G, NP_000124.1:p.Thr194Ala, NP_001300842.1:p.Thr156Ala, XM_005262396.1:c.466A>G, XM_005262397.1:c.451A>G, XM_005262397.4:c.451A>G, XP_005262453.1:p.Thr156Ala, XP_005262454.1:p.Thr151Ala
                                16.

                                rs117998106 has merged into rs6050 [Homo sapiens]
                                  ACCTGGGAGCTCTGGACCTGGAAGT[A/G/T]CTGGAAGCTGGAACTCTGGGAGCTC
                                  Chromosome:
                                  4:154586438
                                  Gene:
                                  FGA (GeneView)
                                  Functional Consequence:
                                  missense
                                  Allele Origin:
                                  G(germline)/A(germline)
                                  Clinical significance:
                                  other
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                  Global MAF:
                                  C=0.3271/1638
                                  HGVS:
                                  NC_000004.11:g.155507590T>C, NC_000004.12:g.154586438T>C, NG_008832.1:g.9308A>G, NM_000508.3:c.991A>G, NM_000508.4:c.991A>G, NM_021871.2:c.991A>G, NM_021871.3:c.991A>G, NP_000499.1:p.Thr331Ala, NP_068657.1:p.Thr331Ala
                                  17.

                                  rs386600996 has merged into rs6003 [Homo sapiens]
                                    TTGTATAAAATTCAAGAGAACATGC[A/G]TTATGGTTGCGCTTCAGGGTACAAA
                                    Chromosome:
                                    1:197061891
                                    Gene:
                                    F13B (GeneView)
                                    Functional Consequence:
                                    missense
                                    Allele Origin:
                                    G(germline)/A(germline)
                                    Clinical significance:
                                    other
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                    Global MAF:
                                    C=0.2382/1193
                                    HGVS:
                                    NC_000001.10:g.197031021C>T, NC_000001.11:g.197061891C>T, NG_012065.1:g.10377G>A, NM_001994.2:c.344G>A, NP_001985.2:p.Arg115His, XM_005244953.1:c.344G>A, XM_005244954.1:c.266-18G>A, XM_005244955.1:c.122-18G>A, XM_011509283.2:c.344G>A, XM_011509284.2:c.344G>A, XM_011509286.2:c.200G>A, XP_005245010.1:p.Arg115His, XP_011507585.1:p.Arg115His, XP_011507586.1:p.Arg115His, XP_011507588.1:p.Arg67His
                                    18.

                                    rs118203905 [Homo sapiens]
                                      CATTAAAAACTGCCCAAAGAAAACC[A/G]GGAATCTTAAGAAAATAACTCGTGA
                                      Chromosome:
                                      1:169555300
                                      Gene:
                                      F5 (GeneView)
                                      Functional Consequence:
                                      missense
                                      Allele Origin:
                                      G(germline)/A(germline)
                                      Clinical significance:
                                      Pathogenic
                                      Validated:
                                      by 1000G,by cluster,by frequency
                                      Global MAF:
                                      C=0.0020/10
                                      HGVS:
                                      NC_000001.10:g.169524538T>C, NC_000001.11:g.169555300T>C, NG_011806.1:g.36232A>G, NM_000130.4:c.1000A>G, NP_000121.2:p.Arg334Gly, XM_017000660.1:c.589A>G, XP_016856149.1:p.Arg197Gly
                                      19.

                                      rs118203911 [Homo sapiens]
                                        CATTTGGATAATTTCTCAAACCAAA[C/T]TGGAAAACATTATAAGAAAGTTATG
                                        Chromosome:
                                        1:169552693
                                        Gene:
                                        F5 (GeneView)
                                        Functional Consequence:
                                        missense
                                        Allele Origin:
                                        T(germline)/C(germline)
                                        Clinical significance:
                                        Pathogenic
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000001.10:g.169521931A>G, NC_000001.11:g.169552693A>G, NG_011806.1:g.38839T>C, NM_000130.4:c.1160T>C, NP_000121.2:p.Ile387Thr, XM_017000660.1:c.749T>C, XP_016856149.1:p.Ile250Thr

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Search details

                                        See more...

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center