Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 8

1.

rs649216 [Homo sapiens]
    GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
    Chromosome:
    19:54813180
    Gene:
    KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
    Functional Consequence:
    intron variant,synonymous codon
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4093/2050
    HGVS:
    NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A
    2.

    rs2984205 has merged into rs649216 [Homo sapiens]
      GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
      Chromosome:
      19:54813180
      Gene:
      KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
      Functional Consequence:
      intron variant,synonymous codon
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.4093/2050
      HGVS:
      NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A
      3.

      rs3198328 has merged into rs649216 [Homo sapiens]
        GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
        Chromosome:
        19:54813180
        Gene:
        KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
        Functional Consequence:
        intron variant,synonymous codon
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.4093/2050
        HGVS:
        NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A
        4.

        rs17423123 has merged into rs649216 [Homo sapiens]
          GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
          Chromosome:
          19:54813180
          Gene:
          KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
          Functional Consequence:
          intron variant,synonymous codon
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.4093/2050
          HGVS:
          NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A
          5.

          rs41437545 has merged into rs649216 [Homo sapiens]
            GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
            Chromosome:
            19:54813180
            Gene:
            KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
            Functional Consequence:
            intron variant,synonymous codon
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            T=0.4093/2050
            HGVS:
            NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A
            6.

            rs59145145 has merged into rs649216 [Homo sapiens]
              GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
              Chromosome:
              19:54813180
              Gene:
              KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
              Functional Consequence:
              intron variant,synonymous codon
              Validated:
              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
              Global MAF:
              T=0.4093/2050
              HGVS:
              NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A
              7.

              rs117787911 has merged into rs649216 [Homo sapiens]
                GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
                Chromosome:
                19:54813180
                Gene:
                KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
                Functional Consequence:
                intron variant,synonymous codon
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                T=0.4093/2050
                HGVS:
                NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A
                8.

                rs146935134 has merged into rs649216 [Homo sapiens]
                  GGTACTCAGTGGCCATCATCCTCTT[C/T]ACCATCCTTCCCTTCTTTCTCCTTC
                  Chromosome:
                  19:54813180
                  Gene:
                  KIR2DL4 (GeneView) KIR3DL1 (GeneView) LOC102724300 (GeneView)
                  Functional Consequence:
                  intron variant,synonymous codon
                  Validated:
                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                  Global MAF:
                  T=0.4093/2050
                  HGVS:
                  NC_000019.10:g.54813180T, NC_000019.10:g.54813180T>C, NC_000019.9:g.55324635T, NC_000019.9:g.55324635T>C, NG_005990.1:g.89152T, NG_005990.1:g.89152T>C, NG_005994.1:g.133644C, NG_005994.1:g.133644C>T, NG_021414.1:g.1743T, NG_021414.1:g.1743T>C, NM_001080770.1:c.707-510C>T, NM_001080770.1:c.707-510T>C, NM_001080772.1:c.762T, NM_001080772.1:c.762T>C, NM_002255.5:c.762T, NM_002255.5:c.762T>C, NM_013289.2:c.35-4360C>T, NM_013289.2:c.35-4360T>C, NP_001074241.1:p.Phe254, NP_002246.5:p.Phe254, NT_113949.2:g.76205G, NT_113949.2:g.76205G>A, NT_187636.1:g.89562G, NT_187636.1:g.89562G>A, NT_187637.1:g.55629A, NT_187637.1:g.55629A>G, NT_187638.1:g.55835G, NT_187638.1:g.55835G>A, NT_187639.1:g.56198G, NT_187639.1:g.56198G>A, NT_187640.1:g.45026G, NT_187640.1:g.45026G>A, NT_187641.1:g.95238G, NT_187641.1:g.95238G>A, NT_187642.1:g.54327G, NT_187642.1:g.54327G>A, NT_187643.1:g.55889G, NT_187643.1:g.55889G>A, NT_187644.1:g.83276G, NT_187644.1:g.83276G>A, NT_187645.1:g.55904G, NT_187645.1:g.55904G>A, NT_187668.1:g.45791A, NT_187668.1:g.45791A>G, NT_187669.1:g.55889G, NT_187669.1:g.55889G>A, NT_187670.1:g.83349G, NT_187670.1:g.83349G>A, NT_187671.1:g.92121C, NT_187671.1:g.92121C>T, NT_187672.1:g.114811C, NT_187672.1:g.114811C>T, NT_187673.1:g.55898A, NT_187673.1:g.55898A>G, NT_187674.1:g.100050C, NT_187674.1:g.100050C>T, NT_187675.1:g.156189C, NT_187675.1:g.156189C>T, NT_187676.1:g.89121C, NT_187676.1:g.89121C>T, NT_187677.1:g.90546T, NT_187677.1:g.90546T>C, NT_187683.1:g.87386C, NT_187683.1:g.87386C>T, NT_187684.1:g.55704A, NT_187684.1:g.55704A>G, NT_187685.1:g.55381G, NT_187685.1:g.55381G>A, NT_187686.1:g.56230A, NT_187686.1:g.56230A>G, NT_187687.1:g.55724A, NT_187687.1:g.55724A>G, NT_187693.1:g.795749T, NT_187693.1:g.795749T>C, NW_003571055.2:g.431044C, NW_003571055.2:g.431044C>T, NW_003571060.1:g.717544C, NW_003571060.1:g.717544C>T, NW_004166865.1:g.787548T, NW_004166865.1:g.787548T>C, XM_005258890.1:c.879T, XM_005258890.1:c.879T>C, XM_005258891.1:c.879T, XM_005258891.1:c.879T>C, XM_005258892.1:c.828T, XM_005258892.1:c.828T>C, XM_005258893.1:c.773-510C>T, XM_005258893.1:c.773-510T>C, XM_005258894.1:c.773-663C>T, XM_005258894.1:c.773-663T>C, XM_005258895.1:c.539-510C>T, XM_005258895.1:c.539-510T>C, XM_005258896.1:c.488-510C>T, XM_005258896.1:c.488-510T>C, XM_005277102.1:c.879C, XM_005277102.1:c.879C>T, XM_005277103.1:c.879C, XM_005277103.1:c.879C>T, XM_005277104.1:c.539-511C>T, XM_005277104.1:c.539-511T>C, XM_005277105.1:c.488-511C>T, XM_005277105.1:c.488-511T>C, XM_005277254.1:c.828C, XM_005277254.1:c.828C>T, XM_005277255.1:c.773-511C>T, XM_005277255.1:c.773-511T>C, XM_005277256.1:c.879C, XM_005277256.1:c.879C>T, XM_005277257.1:c.773-664C>T, XM_005277257.1:c.773-664T>C, XM_005277258.1:c.539-511C>T, XM_005277258.1:c.539-511T>C, XM_005277259.1:c.488-511C>T, XM_005277259.1:c.488-511T>C, XM_005278263.1:c.879T, XM_005278263.1:c.879T>C, XM_005278264.1:c.879T, XM_005278264.1:c.879T>C, XM_005278265.1:c.828T, XM_005278265.1:c.828T>C, XM_005278266.1:c.773-510C>T, XM_005278266.1:c.773-510T>C, XM_005278267.1:c.773-663C>T, XM_005278267.1:c.773-663T>C, XM_005278268.1:c.539-510C>T, XM_005278268.1:c.539-510T>C, XM_005278269.1:c.488-510C>T, XM_005278269.1:c.488-510T>C, XP_005258947.1:p.Phe293, XP_005258948.1:p.Phe293, XP_005258949.1:p.Phe276, XP_005277159.1:p.Phe293, XP_005277160.1:p.Phe293, XP_005277311.1:p.Phe276, XP_005277313.1:p.Phe293, XP_005278320.1:p.Phe293, XP_005278321.1:p.Phe293, XP_005278322.1:p.Phe276, XR_430260.1:n.690+3028A>G, XR_430260.1:n.690+3028G>A, XR_430827.1:n.664+3054A>G, XR_430827.1:n.664+3054G>A, XR_430966.1:n.664+3054A>G, XR_430966.1:n.664+3054G>A, XR_430969.1:n.690+3028A>G, XR_430969.1:n.690+3028G>A, XR_431074.1:n.690+3028A>G, XR_431074.1:n.690+3028G>A, XR_952550.1:n.664+3054A>G, XR_952550.1:n.664+3054G>A, XR_952562.1:n.690+3028A>G, XR_952562.1:n.690+3028G>A

                  Display Settings:

                  Format
                  Items per page
                  Sort by

                  Send to:

                  Choose Destination

                  Supplemental Content

                  Find related data

                  Search details

                  See more...

                  Recent activity

                  Your browsing activity is empty.

                  Activity recording is turned off.

                  Turn recording back on

                  See more...
                  Support Center