Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 2

1.

rs35515638 [Homo sapiens]
    CGACTGAGGTCCCAGATGGTCATGA[A/G]AATGCGGGAATATCTCTGTAATCTG
    Chromosome:
    1:173833470
    Gene:
    DARS2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    G=0.0242/121
    HGVS:
    NC_000001.10:g.173802608A>G, NC_000001.11:g.173833470A>G, NG_016138.1:g.13812A>G, NM_018122.4:c.587A>G, NP_060592.2:p.Lys196Arg, XM_005245299.1:c.362A>G, XM_005245300.1:c.587A>G, XM_006711427.3:c.587A>G, XM_011509711.2:c.587A>G, XP_005245356.1:p.Lys121Arg, XP_005245357.1:p.Lys196Arg, XP_006711490.1:p.Lys196Arg, XP_011508013.1:p.Lys196Arg
    2.

    rs61528142 has merged into rs35515638 [Homo sapiens]
      CGACTGAGGTCCCAGATGGTCATGA[A/G]AATGCGGGAATATCTCTGTAATCTG
      Chromosome:
      1:173833470
      Gene:
      DARS2 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.0242/121
      HGVS:
      NC_000001.10:g.173802608A>G, NC_000001.11:g.173833470A>G, NG_016138.1:g.13812A>G, NM_018122.4:c.587A>G, NP_060592.2:p.Lys196Arg, XM_005245299.1:c.362A>G, XM_005245300.1:c.587A>G, XM_006711427.3:c.587A>G, XM_011509711.2:c.587A>G, XP_005245356.1:p.Lys121Arg, XP_005245357.1:p.Lys196Arg, XP_006711490.1:p.Lys196Arg, XP_011508013.1:p.Lys196Arg

      Supplemental Content

      Find related data

      Search details

      See more...

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center