Display Settings:

Format

Send to:

Choose Destination
  • The following term was ignored: )
  • See the search details.
1.

rs34536443 [Homo sapiens]
    GCGGGCCTGGCTCTCACCGTGGGGG[C/G]GCTCTGGCTGGAGTCACAGTGCGTC
    Chromosome:
    19:10352442
    Gene:
    TYK2 (GeneView)
    Functional Consequence:
    intron variant,missense,nc transcript variant
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.0102/51
    HGVS:
    CM000681.2:g.10352442G>C, NC_000019.10:g.10352442G>C, NC_000019.9:g.10463118G>C, NG_007872.1:g.33131C>G, NM_003331.4:c.3310C>G, NP_003322.3:p.Pro1104Ala, XP_005260106.1:p.Pro1104Ala, XP_011526547.1:p.Pro1104Ala, XP_011526548.1:p.Pro1005Ala, XP_011526549.1:p.Pro1005Ala, XP_011526551.1:p.Pro662Ala, XP_011526553.1:p.Pro523Ala, XR_001753750.1:n.3357+484C>G, XR_001753751.1:n.3862C>G

    Supplemental Content

    Search details

    See more...

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center