Display Settings:

Format

Send to:

Choose Destination
1.

rs3199979 [Homo sapiens]
    TCCTGTTCGACAGTCAGCCGCATCT[C/T]CTTTTGCGTCGCCAGCCGAGCCACA
    Chromosome:
    12:6534554
    Gene:
    GAPDH (GeneView)
    Functional Consequence:
    nc transcript variant,upstream variant 2KB,utr variant 5 prime
    Validated:
    no info
    HGVS:
    CM000674.2:g.6534554T>C, NC_000012.11:g.6643720T>C, NC_000012.12:g.6534554T>C, NG_007073.2:g.5064T>C, NM_001256799.2:c.-1013T>C, NM_001289745.1:c.-131T>C, NM_001289745.2:c.-131T>C, NM_001289746.1:c.-279T>C, NM_001357938.1:c.-39T>C, NM_001357943.1:c.-39T>C, NM_001357944.1:c.-39T>C, NM_002046.5:c.-39T>C, NM_002046.6:c.-39T>C, NR_152150.1:n.38T>C

    Supplemental Content

    Search details

    See more...

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center