Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 3

1.

rs12926089 [Homo sapiens]
    GTGGCCGTGACGGCGGCCACCAGCA[C/T]GGCCTCAATCACCTGCAGGCAGGGC
    Chromosome:
    16:1452856
    Gene:
    CLCN7 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(unknown)/C(germline,unknown)
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0789/395
    HGVS:
    NC_000016.10:g.1452856C>T, NC_000016.9:g.1502857C>T, NG_007567.1:g.27229G>A, NM_001114331.2:c.1180G>A, NM_001287.5:c.1252G>A, NP_001107803.1:p.Val394Met, NP_001278.1:p.Val418Met, XM_011522354.1:c.1078G>A, XP_011520656.1:p.Val360Met
    2.

    rs59307144 has merged into rs12926089 [Homo sapiens]
      GTGGCCGTGACGGCGGCCACCAGCA[C/T]GGCCTCAATCACCTGCAGGCAGGGC
      Chromosome:
      16:1452856
      Gene:
      CLCN7 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(unknown)/C(germline,unknown)
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.0789/395
      HGVS:
      NC_000016.10:g.1452856C>T, NC_000016.9:g.1502857C>T, NG_007567.1:g.27229G>A, NM_001114331.2:c.1180G>A, NM_001287.5:c.1252G>A, NP_001107803.1:p.Val394Met, NP_001278.1:p.Val418Met, XM_011522354.1:c.1078G>A, XP_011520656.1:p.Val360Met
      3.

      rs117279632 has merged into rs12926089 [Homo sapiens]
        GTGGCCGTGACGGCGGCCACCAGCA[C/T]GGCCTCAATCACCTGCAGGCAGGGC
        Chromosome:
        16:1452856
        Gene:
        CLCN7 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        T(unknown)/C(germline,unknown)
        Clinical significance:
        Likely benign
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0789/395
        HGVS:
        NC_000016.10:g.1452856C>T, NC_000016.9:g.1502857C>T, NG_007567.1:g.27229G>A, NM_001114331.2:c.1180G>A, NM_001287.5:c.1252G>A, NP_001107803.1:p.Val394Met, NP_001278.1:p.Val418Met, XM_011522354.1:c.1078G>A, XP_011520656.1:p.Val360Met

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Search details

        See more...

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center