Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 2

1.

rs12085877 [Homo sapiens]
    TCCATATATACGCCCTCCTGTTGTG[C/T]GGGCTGATAGTCCACAAACTGGAGA
    Chromosome:
    1:11027630
    Gene:
    MASP2 (GeneView) TARDBP (GeneView)
    Functional Consequence:
    intron variant,missense
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.0288/144
    HGVS:
    NC_000001.10:g.11087687C>T, NC_000001.11:g.11027630C>T, NG_007289.2:g.24599G>A, NM_006610.3:c.1316G>A, NP_006601.2:p.Arg439His, XM_017000863.1:c.*3011+1965C>T, XM_017000864.1:c.*1895+1965C>T, XM_017000865.1:c.*1781-2057C>T
    2.

    rs52829987 has merged into rs12085877 [Homo sapiens]
      TCCATATATACGCCCTCCTGTTGTG[C/T]GGGCTGATAGTCCACAAACTGGAGA
      Chromosome:
      1:11027630
      Gene:
      MASP2 (GeneView) TARDBP (GeneView)
      Functional Consequence:
      intron variant,missense
      Clinical significance:
      Likely benign
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.0288/144
      HGVS:
      NC_000001.10:g.11087687C>T, NC_000001.11:g.11027630C>T, NG_007289.2:g.24599G>A, NM_006610.3:c.1316G>A, NP_006601.2:p.Arg439His, XM_017000863.1:c.*3011+1965C>T, XM_017000864.1:c.*1895+1965C>T, XM_017000865.1:c.*1781-2057C>T

      Supplemental Content

      Find related data

      Search details

      See more...

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center