Display Settings:

Format

Send to:

Choose Destination
1.

rs11549332 [Homo sapiens]
    CCTGTTCGACAGTCAGCCGCATCTT[C/T]TTTTGCGTCGCCAGCCGAGCCACAT
    Chromosome:
    12:6534555
    Gene:
    GAPDH (GeneView)
    Functional Consequence:
    nc transcript variant,upstream variant 2KB,utr variant 5 prime
    Validated:
    no info
    HGVS:
    CM000674.2:g.6534555C>T, NC_000012.11:g.6643721C>T, NC_000012.12:g.6534555C>T, NG_007073.2:g.5065C>T, NM_001256799.2:c.-1012C>T, NM_001289745.1:c.-130C>T, NM_001289745.2:c.-130C>T, NM_001289746.1:c.-278C>T, NM_001357938.1:c.-38C>T, NM_001357943.1:c.-38C>T, NM_001357944.1:c.-38C>T, NM_002046.5:c.-38C>T, NM_002046.6:c.-38C>T, NR_152150.1:n.39C>T

    Supplemental Content

    Search details

    See more...

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center