Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 25

3.

rs121912602 [Homo sapiens]
    AAAGGCCAAGATGCACAAAGAGTGT[C/G/T]GAAGCCGGAGTGGTTCTGATCCTCA
    Chromosome:
    10:94254256
    Gene:
    PLCE1 (GeneView)
    Functional Consequence:
    missense,stop gained
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000010.10:g.96014013C>G, NC_000010.10:g.96014013C>T, NC_000010.11:g.94254256C>G, NC_000010.11:g.94254256C>T, NG_015799.1:g.265268C>G, NG_015799.1:g.265268C>T, NM_001165979.2:c.2422C>G, NM_001165979.2:c.2422C>T, NM_001288989.1:c.3346C>G, NM_001288989.1:c.3346C>T, NM_016341.3:c.3346C>G, NM_016341.3:c.3346C>T, NP_001159451.1:p.Arg808Gly, NP_001159451.1:p.Arg808Ter, NP_001275918.1:p.Arg1116Gly, NP_001275918.1:p.Arg1116Ter, NP_057425.3:p.Arg1116Gly, NP_057425.3:p.Arg1116Ter, XM_005269880.1:c.3346C>G, XM_005269880.1:c.3346C>T, XM_005269881.1:c.3346C>G, XM_005269881.1:c.3346C>T, XM_005269882.1:c.511C>G, XM_005269882.1:c.511C>T, XM_006717885.3:c.3346C>G, XM_006717885.3:c.3346C>T, XM_006717888.3:c.3346C>G, XM_006717888.3:c.3346C>T, XM_006717889.3:c.3346C>G, XM_006717889.3:c.3346C>T, XM_006717890.2:c.2422C>G, XM_006717890.2:c.2422C>T, XM_011539849.2:c.3346C>G, XM_011539849.2:c.3346C>T, XM_011539850.2:c.2191C>G, XM_011539850.2:c.2191C>T, XM_011539851.2:c.3346C>G, XM_011539851.2:c.3346C>T, XM_011539852.2:c.3346C>G, XM_011539852.2:c.3346C>T, XM_017016310.1:c.3346C>G, XM_017016310.1:c.3346C>T, XM_017016311.1:c.3346C>G, XM_017016311.1:c.3346C>T, XM_017016312.1:c.2422C>G, XM_017016312.1:c.2422C>T, XP_005269937.1:p.Arg1116Gly, XP_005269937.1:p.Arg1116Ter, XP_005269938.1:p.Arg1116Gly, XP_005269938.1:p.Arg1116Ter, XP_005269939.1:p.Arg171Gly, XP_005269939.1:p.Arg171Ter, XP_006717948.1:p.Arg1116Gly, XP_006717948.1:p.Arg1116Ter, XP_006717951.1:p.Arg1116Gly, XP_006717951.1:p.Arg1116Ter, XP_006717952.1:p.Arg1116Gly, XP_006717952.1:p.Arg1116Ter, XP_006717953.1:p.Arg808Gly, XP_006717953.1:p.Arg808Ter, XP_011538151.1:p.Arg1116Gly, XP_011538151.1:p.Arg1116Ter, XP_011538152.1:p.Arg731Gly, XP_011538152.1:p.Arg731Ter, XP_011538153.1:p.Arg1116Gly, XP_011538153.1:p.Arg1116Ter, XP_011538154.1:p.Arg1116Gly, XP_011538154.1:p.Arg1116Ter, XP_016871799.1:p.Arg1116Gly, XP_016871799.1:p.Arg1116Ter, XP_016871800.1:p.Arg1116Gly, XP_016871800.1:p.Arg1116Ter, XP_016871801.1:p.Arg808Gly, XP_016871801.1:p.Arg808Ter
    8.
    10.
    12.

    rs121918187 [Homo sapiens]
      TACTCGACGATCGACACGTGGCCAG[A/G]CCGGCGGAGCGGAGGCATGATCGTC
      Chromosome:
      22:45293214
      Gene:
      UPK3A (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Uncertain significance
      Validated:
      no info
      HGVS:
      NC_000022.10:g.45689095G>A, NC_000022.11:g.45293214G>A, NG_016203.1:g.13228G>A, NM_001167574.1:c.242G>A, NM_006953.3:c.605G>A, NP_001161046.1:p.Gly81Asp, NP_008884.1:p.Gly202Asp
      15.

      rs121918671 [Homo sapiens]
        CAAGGAGCTGCAGGCGCTCAACACC[C/G/T]AGGAGGCGGCGGAGCAGCGGGCGGA
        Chromosome:
        17:37744584
        Gene:
        HNF1B (GeneView)
        Functional Consequence:
        missense,stop gained
        Allele Origin:
        G(germline)/T(germline)
        Clinical significance:
        Pathogenic
        Validated:
        by cluster
        HGVS:
        NC_000017.10:g.36104575C>A, NC_000017.10:g.36104575C>G, NC_000017.11:g.37744584C>A, NC_000017.11:g.37744584C>G, NG_013019.2:g.5523G>C, NG_013019.2:g.5523G>T, NM_000458.3:c.301G>C, NM_000458.3:c.301G>T, NM_001165923.3:c.301G>C, NM_001165923.3:c.301G>T, NM_001304286.1:c.301G>C, NM_001304286.1:c.301G>T, NP_000449.1:p.Glu101Gln, NP_000449.1:p.Glu101Ter, NP_001159395.1:p.Glu101Gln, NP_001159395.1:p.Glu101Ter, NP_001291215.1:p.Glu101Gln, NP_001291215.1:p.Glu101Ter, NT_187614.1:g.1983640C>A, NT_187614.1:g.1983640C>G, XM_005257629.1:c.301G>C, XM_005257629.1:c.301G>T, XM_005257630.1:c.301G>C, XM_005257630.1:c.301G>T, XM_011525160.1:c.301G>C, XM_011525160.1:c.301G>T, XM_011525161.1:c.301G>C, XM_011525161.1:c.301G>T, XM_011525162.2:c.301G>C, XM_011525162.2:c.301G>T, XM_011525163.2:c.301G>C, XM_011525163.2:c.301G>T, XM_011525164.1:c.301G>C, XM_011525164.1:c.301G>T, XP_005257686.1:p.Glu101Gln, XP_005257686.1:p.Glu101Ter, XP_005257687.1:p.Glu101Gln, XP_005257687.1:p.Glu101Ter, XP_011523462.1:p.Glu101Gln, XP_011523462.1:p.Glu101Ter, XP_011523463.1:p.Glu101Gln, XP_011523463.1:p.Glu101Ter, XP_011523464.1:p.Glu101Gln, XP_011523464.1:p.Glu101Ter, XP_011523465.1:p.Glu101Gln, XP_011523465.1:p.Glu101Ter, XP_011523466.1:p.Glu101Gln, XP_011523466.1:p.Glu101Ter
        19.

        rs137852947 [Homo sapiens]
          TGACATCCTCCTAAGATGTGGGAGT[C/T]GAGTGGGTCTGTCTTTTCCATTTCT
          Chromosome:
          6:51847871
          Gene:
          PKHD1 (GeneView)
          Functional Consequence:
          nc transcript variant,stop gained
          Allele Origin:
          T(germline)/C(germline)
          Clinical significance:
          Pathogenic
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          A=0.0004/2
          HGVS:
          NC_000006.11:g.51712669G>A, NC_000006.12:g.51847871G>A, NG_008753.1:g.244755C>T, NM_138694.3:c.8011C>T, NM_170724.2:c.8011C>T, NP_619639.3:p.Arg2671Ter, NP_733842.2:p.Arg2671Ter, XM_011514680.2:c.8011C>T, XM_011514682.2:c.8011C>T, XM_011514683.2:c.7369C>T, XM_011514684.2:c.7300C>T, XM_011514685.1:c.8011C>T, XM_011514686.2:c.8011C>T, XM_011514687.1:c.8011C>T, XM_011514688.2:c.8011C>T, XM_011514690.2:c.2086C>T, XM_011514691.2:c.2086C>T, XM_017010944.1:c.8011C>T, XM_017010945.1:c.7936C>T, XM_017010946.1:c.8011C>T, XM_017010947.1:c.7747C>T, XM_017010948.1:c.7300C>T, XM_017010949.1:c.6151C>T, XM_017010950.1:c.8011C>T, XM_017010951.1:c.8011C>T, XM_017010952.1:c.8011C>T, XP_011512982.1:p.Arg2671Ter, XP_011512984.1:p.Arg2671Ter, XP_011512985.1:p.Arg2457Ter, XP_011512986.1:p.Arg2434Ter, XP_011512987.1:p.Arg2671Ter, XP_011512988.1:p.Arg2671Ter, XP_011512989.1:p.Arg2671Ter, XP_011512990.1:p.Arg2671Ter, XP_011512992.1:p.Arg696Ter, XP_011512993.1:p.Arg696Ter, XP_016866433.1:p.Arg2671Ter, XP_016866434.1:p.Arg2646Ter, XP_016866435.1:p.Arg2671Ter, XP_016866436.1:p.Arg2583Ter, XP_016866437.1:p.Arg2434Ter, XP_016866438.1:p.Arg2051Ter, XP_016866439.1:p.Arg2671Ter, XP_016866440.1:p.Arg2671Ter, XP_016866441.1:p.Arg2671Ter, XR_001743469.1:n.8287C>T
          20.

          rs137852949 [Homo sapiens]
            ACGGGAGAAGCACCAGATCCGAGTC[C/G/T]GAGCCCAGAGGCTTCCAGAAGTACA
            Chromosome:
            6:52058349
            Gene:
            PKHD1 (GeneView)
            Functional Consequence:
            missense,nc transcript variant,stop gained,upstream variant 2KB
            Allele Origin:
            T(germline)/C(germline)
            Clinical significance:
            Pathogenic
            Validated:
            by cluster,by frequency
            HGVS:
            NC_000006.11:g.51923147G>A, NC_000006.11:g.51923147G>C, NC_000006.12:g.52058349G>A, NC_000006.12:g.52058349G>C, NG_008753.1:g.34277C>G, NG_008753.1:g.34277C>T, NM_138694.3:c.1486C>G, NM_138694.3:c.1486C>T, NM_170724.2:c.1486C>G, NM_170724.2:c.1486C>T, NP_619639.3:p.Arg496Gly, NP_619639.3:p.Arg496Ter, NP_733842.2:p.Arg496Gly, NP_733842.2:p.Arg496Ter, XM_011514680.2:c.1486C>G, XM_011514680.2:c.1486C>T, XM_011514682.2:c.1486C>G, XM_011514682.2:c.1486C>T, XM_011514683.2:c.1486C>G, XM_011514683.2:c.1486C>T, XM_011514684.2:c.775C>G, XM_011514684.2:c.775C>T, XM_011514685.1:c.1486C>G, XM_011514685.1:c.1486C>T, XM_011514686.2:c.1486C>G, XM_011514686.2:c.1486C>T, XM_011514687.1:c.1486C>G, XM_011514687.1:c.1486C>T, XM_011514688.2:c.1486C>G, XM_011514688.2:c.1486C>T, XM_017010944.1:c.1486C>G, XM_017010944.1:c.1486C>T, XM_017010945.1:c.1411C>G, XM_017010945.1:c.1411C>T, XM_017010946.1:c.1486C>G, XM_017010946.1:c.1486C>T, XM_017010947.1:c.1486C>G, XM_017010947.1:c.1486C>T, XM_017010948.1:c.775C>G, XM_017010948.1:c.775C>T, XM_017010949.1:c.-2815C>G, XM_017010949.1:c.-2815C>T, XM_017010950.1:c.1486C>G, XM_017010950.1:c.1486C>T, XM_017010951.1:c.1486C>G, XM_017010951.1:c.1486C>T, XM_017010952.1:c.1486C>G, XM_017010952.1:c.1486C>T, XP_011512982.1:p.Arg496Gly, XP_011512982.1:p.Arg496Ter, XP_011512984.1:p.Arg496Gly, XP_011512984.1:p.Arg496Ter, XP_011512985.1:p.Arg496Gly, XP_011512985.1:p.Arg496Ter, XP_011512986.1:p.Arg259Gly, XP_011512986.1:p.Arg259Ter, XP_011512987.1:p.Arg496Gly, XP_011512987.1:p.Arg496Ter, XP_011512988.1:p.Arg496Gly, XP_011512988.1:p.Arg496Ter, XP_011512989.1:p.Arg496Gly, XP_011512989.1:p.Arg496Ter, XP_011512990.1:p.Arg496Gly, XP_011512990.1:p.Arg496Ter, XP_016866433.1:p.Arg496Gly, XP_016866433.1:p.Arg496Ter, XP_016866434.1:p.Arg471Gly, XP_016866434.1:p.Arg471Ter, XP_016866435.1:p.Arg496Gly, XP_016866435.1:p.Arg496Ter, XP_016866436.1:p.Arg496Gly, XP_016866436.1:p.Arg496Ter, XP_016866437.1:p.Arg259Gly, XP_016866437.1:p.Arg259Ter, XP_016866439.1:p.Arg496Gly, XP_016866439.1:p.Arg496Ter, XP_016866440.1:p.Arg496Gly, XP_016866440.1:p.Arg496Ter, XP_016866441.1:p.Arg496Gly, XP_016866441.1:p.Arg496Ter, XR_001743469.1:n.1762C>G, XR_001743469.1:n.1762C>T

            Display Settings:

            Format
            Items per page
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Search details

            See more...

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center