Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 4370

1.

rs527236151 [Homo sapiens]
    CAAGGTGCACACGCGGCGCAGGTGC[C/T]GCAACCGCTTCGTCAAGAAGAATGG
    Chromosome:
    17:21702913
    Gene:
    KCNJ18 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    CM000679.2:g.21702913C>T, NC_000017.11:g.21702913C>T, NG_033093.1:g.15391C>T, NM_001194958.2:c.127C>T, NP_001181887.2:p.Arg43Cys, NW_003315950.2:g.355278C>T, XP_005276976.1:p.Arg145Cys
    2.

    rs527236152 [Homo sapiens]
      GCGGCCTTCCTCTTCTCCATCGAGA[C/T]GCAGACCACCATCGGCTACGGGCTG
      Chromosome:
      17:21703205
      Gene:
      KCNJ18 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster
      HGVS:
      CM000679.2:g.21703205C>T, NC_000017.11:g.21703205C>T, NG_033093.1:g.15683C>T, NM_001194958.2:c.419C>T, NP_001181887.2:p.Thr140Met, NW_003315950.2:g.355570C>T, XP_005276976.1:p.Thr242Met
      3.

      rs527236153 [Homo sapiens]
        TCTTCTCCATCGAGACGCAGACCAC[-/C]ATCGGCTACGGGCTGCGCTGTGTGA
        Chromosome:
        17:21703215
        Gene:
        KCNJ18 (GeneView)
        Functional Consequence:
        frameshift variant
        Allele Origin:
        C(germline)/(germline)
        Clinical significance:
        Pathogenic
        Validated:
        by cluster
        HGVS:
        CM000679.2:g.21703215delC, NC_000017.11:g.21703215delC, NG_033093.1:g.15693delC, NM_001194958.2:c.429delC, NP_001181887.2:p.Ile144Serfs, NW_003315950.2:g.355580delC, XP_005276976.1:p.Ile246Serfs
        4.

        rs527236154 [Homo sapiens]
          CTTCATGGTGGTGGCCCAGTCCATC[A/G]TGGGCTGCATCATCGACTCCTTCAT
          Chromosome:
          17:21703288
          Gene:
          KCNJ18 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          Pathogenic
          Validated:
          by cluster
          HGVS:
          CM000679.2:g.21703288G>A, NC_000017.11:g.21703288G>A, NG_033093.1:g.15766G>A, NM_001194958.2:c.502G>A, NP_001181887.2:p.Val168Met, NW_003315950.2:g.355653G>A, XP_005276976.1:p.Val270Met
          5.
          6.

          rs527236156 [Homo sapiens]
            TGAGGCGGACGGAGACCAGGACGGC[C/T]GAAGCCGGGATGGCCTCAGCCCCCA
            Chromosome:
            17:21703981
            Gene:
            KCNJ18 (GeneView)
            Functional Consequence:
            stop gained
            Allele Origin:
            T(germline)/C(germline)
            Clinical significance:
            Pathogenic
            Validated:
            by cluster
            HGVS:
            CM000679.2:g.21703981C>T, NC_000017.11:g.21703981C>T, NG_033093.1:g.16459C>T, NM_001194958.2:c.1195C>T, NP_001181887.2:p.Arg399Ter, NW_003315950.2:g.356346C>T, XP_005276976.1:p.Arg501Ter
            7.

            rs527236157 [Homo sapiens]
              CCGAAGCCGGGATGGCCTCAGCCCC[C/T]AGGCCAGGCATGACTTTGACAGACT
              Chromosome:
              17:21704005
              Gene:
              KCNJ18 (GeneView)
              Functional Consequence:
              stop gained
              Allele Origin:
              T(germline)/C(germline)
              Clinical significance:
              Pathogenic
              Validated:
              by cluster
              HGVS:
              CM000679.2:g.21704005C>T, NC_000017.11:g.21704005C>T, NG_033093.1:g.16483C>T, NM_001194958.2:c.1219C>T, NP_001181887.2:p.Gln407Ter, NW_003315950.2:g.356370C>T, XP_005276976.1:p.Gln509Ter
              8.

              rs527236158 [Homo sapiens]
                CACAAGACCTATGAGGTGCCCTCTA[C/T]GCCCCGCTGCAGTGCGAAGGATCTG
                Chromosome:
                17:21703847
                Gene:
                KCNJ18 (GeneView)
                Functional Consequence:
                missense
                Allele Origin:
                T(germline)/C(germline)
                Clinical significance:
                Pathogenic
                Validated:
                by cluster
                HGVS:
                CM000679.2:g.21703847C>T, NC_000017.11:g.21703847C>T, NG_033093.1:g.16325C>T, NM_001194958.2:c.1061C>T, NP_001181887.2:p.Thr354Met, NW_003315950.2:g.356212C>T, XP_005276976.1:p.Thr456Met
                9.

                rs527236159 [Homo sapiens]
                  AGTGCGAAGGATCTGGTAGAGAACA[A/G]GTTCCTGCTGCCCAGTGCCAACTCC
                  Chromosome:
                  17:21703883
                  Gene:
                  KCNJ18 (GeneView)
                  Functional Consequence:
                  missense
                  Allele Origin:
                  G(germline)/A(germline)
                  Clinical significance:
                  Pathogenic
                  Validated:
                  by cluster
                  HGVS:
                  CM000679.2:g.21703883A>G, NC_000017.11:g.21703883A>G, NG_033093.1:g.16361A>G, NM_001194958.2:c.1097A>G, NP_001181887.2:p.Lys366Arg, NW_003315950.2:g.356248A>G, XP_005276976.1:p.Lys468Arg
                  10.

                  rs672601244 [Homo sapiens]
                    AGCCACAACGCCGTGGTGGCCCTGC[A/G]TGACGGCAAGCTCTGCCTCATGTGG
                    Chromosome:
                    17:21703400
                    Gene:
                    KCNJ18 (GeneView)
                    Functional Consequence:
                    missense
                    Allele Origin:
                    G(germline)/A(germline)
                    Clinical significance:
                    other
                    Validated:
                    by cluster
                    HGVS:
                    CM000679.2:g.21703400G>A, NC_000017.11:g.21703400G>A, NG_033093.1:g.15878G>A, NM_001194958.2:c.614G>A, NP_001181887.2:p.Arg205His, NW_003315950.2:g.355765G>A, XP_005276976.1:p.Arg307His
                    11.

                    rs1657710 [Homo sapiens]
                      GAGAGGCCTGGCAGGCGACACCAGC[C/T]TCATTTTTCAGGGGAAGCTGAGCCT
                      Chromosome:
                      17:21692915
                      Gene:
                      KCNJ18 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      no info
                      HGVS:
                      CM000679.2:g.21692915C>T, NC_000017.11:g.21692915C>T, NG_033093.1:g.5393C>T, NM_001194958.2:c.-179+201C>T, NW_003315950.2:g.345280C>T
                      12.

                      rs1657715 [Homo sapiens]
                        cgtccatccatccacccatccatcT[C/T]TGAACCTCTGTGTCCCCATCAGTTT
                        Chromosome:
                        17:21693833
                        Gene:
                        KCNJ18 (GeneView)
                        Functional Consequence:
                        intron variant
                        Validated:
                        no info
                        HGVS:
                        CM000679.2:g.21693833C>T, NC_000017.11:g.21693833C>T, NG_033093.1:g.6311C>T, NM_001194958.2:c.-179+1119C>T, NW_003315950.2:g.346198C>T
                        13.

                        rs2118243 [Homo sapiens]
                          GCATCCACCCGGCTTCCTCAGCCTC[C/T]GCCTTGGGTGGGGGTTTCCTGGGGC
                          Chromosome:
                          17:21705855
                          Gene:
                          KCNJ18 (GeneView)
                          Functional Consequence:
                          downstream variant 500B
                          Validated:
                          no info
                          HGVS:
                          CM000679.2:g.21705855C>T, NC_000017.11:g.21705855C>T, NG_033093.1:g.18333C>T, NW_003315950.2:g.358220C>T
                          14.

                          rs3752036 [Homo sapiens]
                            ACCACCTGTGTGGACATCCGCTGGC[C/G]CTACATGCTGCTCATCTTCTCGCTG
                            Chromosome:
                            17:21703028
                            Gene:
                            KCNJ18 (GeneView)
                            Functional Consequence:
                            missense
                            Validated:
                            no info
                            HGVS:
                            CM000679.2:g.21703028G>C, NC_000017.11:g.21703028G>C, NG_033093.1:g.15506G>C, NM_001194958.2:c.242G>C, NP_001181887.2:p.Arg81Pro, NW_003315950.2:g.355393G>C, XP_005276976.1:p.Arg183Pro
                            15.

                            rs4021092 [Homo sapiens]
                              AGTCCACTTGAAGAACAGACCAGGG[A/C]CTGGGCTGGGAGCTTTTAGAGAGGA
                              Chromosome:
                              17:21698760
                              Gene:
                              KCNJ18 (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB
                              Validated:
                              no info
                              HGVS:
                              CM000679.2:g.21698760G>T, NC_000017.11:g.21698760G>T, NG_033093.1:g.11238G>T, NM_001194958.2:c.-57+2656G>T, NW_003315950.2:g.351125G>T
                              17.

                              rs35195987 [Homo sapiens]
                                AAATAGACTCTTCAGAGCCCTCAGT[A/G]TGGGAGTGAGGTGTGGAGCTGAGGT
                                Chromosome:
                                17:21702499
                                Gene:
                                KCNJ18 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                no info
                                HGVS:
                                CM000679.2:g.21702499G>A, NC_000017.11:g.21702499G>A, NG_033093.1:g.14977G>A, NM_001194958.2:c.-56-232G>A, NW_003315950.2:g.354864G>A
                                18.

                                rs35280892 [Homo sapiens]
                                  AAGAAAAATAATGTGTTTGTTTAAA[AA/TC]GGACCCATGTGCTTAATATATAAAG
                                  Chromosome:
                                  17:21690715
                                  Gene:
                                  KCNJ18 (GeneView)
                                  Functional Consequence:
                                  upstream variant 2KB
                                  Validated:
                                  no info
                                  HGVS:
                                  CM000679.2:g.21690715_21690716delTTinsGA, NC_000017.11:g.21690715_21690716delTTinsGA, NG_033093.1:g.3193_3194delTTinsGA, NM_001194958.2:c.-2178_-2177delTTinsGA, NW_003315950.2:g.343080_343081delTTinsGA
                                  19.

                                  rs35289757 [Homo sapiens]
                                    GTATCTGCCAGTGGGGAGGCAGCAG[C/T]GAGCAGCAGGGGTGACAACCCCGCC
                                    Chromosome:
                                    17:21691714
                                    Gene:
                                    KCNJ18 (GeneView)
                                    Functional Consequence:
                                    upstream variant 2KB
                                    Validated:
                                    no info
                                    HGVS:
                                    CM000679.2:g.21691714G>A, NC_000017.11:g.21691714G>A, NG_033093.1:g.4192G>A, NM_001194958.2:c.-1179G>A, NW_003315950.2:g.344079G>A
                                    20.

                                    rs36136271 [Homo sapiens]
                                      GAACCCATGTACTTGAGTGTGTGTC[C/G/T]GTGTGCAGCCTATGCCTGCTGCTCA
                                      Chromosome:
                                      17:21705489
                                      Gene:
                                      KCNJ18 (GeneView)
                                      Functional Consequence:
                                      utr variant 3 prime
                                      Validated:
                                      no info
                                      HGVS:
                                      CM000679.2:g.21705489T>C, CM000679.2:g.21705489T>G, NC_000017.11:g.21705489T>C, NC_000017.11:g.21705489T>G, NG_033093.1:g.17967T>C, NG_033093.1:g.17967T>G, NW_003315950.2:g.357854T>C

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Search details

                                      See more...

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center