Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 686600501

1.

rs248 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    G>A [Show Flanks]
    Chromosome:
    8:19953315 (GRCh38)
    8:19810826 (GRCh37)
    Gene:
    LPL (Varview)
    Functional Consequence:
    coding_sequence_variant,synonymous_variant
    Clinical significance:
    benign,likely-benign
    Validated:
    by frequency,by cluster
    MAF:
    A=0.038738/194 (1000Genomes)
    A=0.049866/12534 (GnomAD_exomes)
    A=0.051312/6226 (ExAC)
    A=0.055356/6951 (TOPMED)
    A=0.065431/851 (GoESP)
    A=0.066907/2101 (GnomAD)
    A=0.06876/265 (ALSPAC)
    A=0.072816/270 (TWINSUK)
    A=0.081667/49 (NorthernSweden)
    A=0.121429/544 (Estonian)
    HGVS:
    NC_000008.11:g.19953315G>A, NC_000008.10:g.19810826G>A, NG_008855.2:g.56599G>A, NG_008855.1:g.19245G>A, NM_000237.3:c.435G>A, NM_000237.2:c.435G>A
    2.

    rs268 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      A>G [Show Flanks]
      Chromosome:
      8:19956018 (GRCh38)
      8:19813529 (GRCh37)
      Gene:
      LPL (Varview)
      Functional Consequence:
      missense_variant,coding_sequence_variant
      Clinical significance:
      risk-factor,pathogenic
      Validated:
      by frequency,by cluster
      MAF:
      G=0.004968/391 (PAGE_STUDY)
      G=0.005192/26 (1000Genomes)
      G=0.01091/1370 (TOPMED)
      G=0.01278/3212 (GnomAD_exomes)
      G=0.013363/1622 (ExAC)
      G=0.014485/455 (GnomAD)
      G=0.018682/72 (ALSPAC)
      G=0.019957/74 (TWINSUK)
      G=0.023884/107 (Estonian)
      G=0.028333/17 (NorthernSweden)
      HGVS:
      NC_000008.11:g.19956018A>G, NC_000008.10:g.19813529A>G, NG_008855.2:g.59302A>G, NG_008855.1:g.21948A>G, NM_000237.3:c.953A>G, NM_000237.2:c.953A>G, NP_000228.1:p.Asn318Ser
      3.

      rs300 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        A>G [Show Flanks]
        Chromosome:
        8:19959376 (GRCh38)
        8:19816887 (GRCh37)
        Gene:
        LPL (Varview)
        Functional Consequence:
        missense_variant,coding_sequence_variant
        Clinical significance:
        likely-benign
        Validated:
        by frequency,by cluster
        MAF:
        G=0.0008/201 (GnomAD_exomes)
        G=0.001084/131 (ExAC)
        G=0.002677/84 (GnomAD)
        G=0.003536/444 (TOPMED)
        G=0.003794/19 (1000Genomes)
        G=0.004383/57 (GoESP)
        G=0.006303/496 (PAGE_STUDY)
        HGVS:
        NC_000008.11:g.19959376A>G, NC_000008.10:g.19816887A>G, NG_008855.2:g.62660A>G, NG_008855.1:g.25306A>G, NM_000237.3:c.1135A>G, NM_000237.2:c.1135A>G, NP_000228.1:p.Thr379Ala
        4.

        rs316 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          C>A,T [Show Flanks]
          Chromosome:
          8:19960925 (GRCh38)
          8:19818436 (GRCh37)
          Gene:
          LPL (Varview)
          Functional Consequence:
          coding_sequence_variant,synonymous_variant
          Clinical significance:
          likely-benign
          Validated:
          by frequency,by cluster
          MAF:
          A=0.081433/50 (Vietnamese)
          A=0.115965/430 (TWINSUK)
          A=0.126667/76 (NorthernSweden)
          A=0.127141/490 (ALSPAC)
          A=0.152556/764 (1000Genomes)
          A=0.155955/19583 (TOPMED)
          A=0.158619/2063 (GoESP)
          A=0.159943/5011 (GnomAD)
          A=0.162071/12755 (PAGE_STUDY)
          A=0.169866/761 (Estonian)
          HGVS:
          NC_000008.11:g.19960925C>A, NC_000008.11:g.19960925C>T, NC_000008.10:g.19818436C>A, NC_000008.10:g.19818436C>T, NG_008855.2:g.64209C>A, NG_008855.2:g.64209C>T, NG_008855.1:g.26855C>A, NG_008855.1:g.26855C>T, NM_000237.3:c.1164C>A, NM_000237.3:c.1164C>T, NM_000237.2:c.1164C>A, NM_000237.2:c.1164C>T
          5.

          rs326 [Homo sapiens]
            Variant type:
            SNV
            Alleles:
            A>G [Show Flanks]
            Chromosome:
            8:19961928 (GRCh38)
            8:19819439 (GRCh37)
            Gene:
            LPL (Varview)
            Functional Consequence:
            intron_variant
            Clinical significance:
            association
            Validated:
            by frequency,by cluster
            MAF:
            G=0.180556/39 (Vietnamese)
            G=0.263333/158 (NorthernSweden)
            G=0.272768/1222 (Estonian)
            G=0.29398/1133 (ALSPAC)
            G=0.295577/1096 (TWINSUK)
            G=0.349441/1750 (1000Genomes)
            G=0.358872/11237 (GnomAD)
            G=0.376298/47251 (TOPMED)
            G=0.392347/30873 (PAGE_STUDY)
            HGVS:
            NC_000008.11:g.19961928A>G, NC_000008.10:g.19819439A>G, NG_008855.2:g.65212A>G, NG_008855.1:g.27858A>G
            6.

            rs328 [Homo sapiens]
              Variant type:
              SNV
              Alleles:
              C>G [Show Flanks]
              Chromosome:
              8:19962213 (GRCh38)
              8:19819724 (GRCh37)
              Gene:
              LPL (Varview)
              Functional Consequence:
              stop_gained,coding_sequence_variant
              Clinical significance:
              likely-benign,benign
              Validated:
              by frequency,by cluster
              MAF:
              G=0.066964/300 (Estonian)
              G=0.07904/6220 (PAGE_STUDY)
              G=0.085/51 (NorthernSweden)
              G=0.086979/2728 (GnomAD)
              G=0.089712/11265 (TOPMED)
              G=0.092156/23148 (GnomAD_exomes)
              G=0.092452/463 (1000Genomes)
              G=0.093501/11340 (ExAC)
              G=0.106642/411 (ALSPAC)
              G=0.107875/400 (TWINSUK)
              G=0.127036/78 (Vietnamese)
              HGVS:
              NC_000008.11:g.19962213C>G, NC_000008.10:g.19819724C>G, NG_008855.2:g.65497C>G, NG_008855.1:g.28143C>G, NM_000237.3:c.1421C>G, NM_000237.2:c.1421C>G, NP_000228.1:p.Ser474Ter
              7.

              rs333 [Homo sapiens]
                Variant type:
                DELINS
                Alleles:
                GTCAGTATCAATTCTGGAAGAATTTCCAGACA>- [Show Flanks]
                Chromosome:
                3:46373453 (GRCh38)
                3:46414944 (GRCh37)
                Gene:
                CCR5 (Varview), LOC102724297 (Varview)
                Functional Consequence:
                intron_variant,coding_sequence_variant,frameshift
                Clinical significance:
                risk-factor,protective
                Validated:
                by frequency,by cluster
                MAF:
                -=0.00463/1 (Vietnamese)
                -=0.024652/1940 (PAGE_STUDY)
                -=0.029153/146 (1000Genomes)
                -=0.060429/755 (GoESP)
                -=0.072628/8805 (ExAC)
                -=0.074164/275 (TWINSUK)
                -=0.074261/18640 (GnomAD_exomes)
                -=0.077421/2427 (GnomAD)
                -=0.093669/361 (ALSPAC)
                -=0.106667/64 (NorthernSweden)
                -=0.117857/528 (Estonian)
                HGVS:
                NC_000003.12:g.46373456_46373487del, NC_000003.11:g.46414947_46414978del, NG_012637.1:g.8315_8346del, NM_000579.3:c.554_585del, NM_001100168.1:c.554_585del, NP_000570.1:p.Ser185fs, NP_001093638.1:p.Ser185fs
                9.

                rs544 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  A>C,G [Show Flanks]
                  Chromosome:
                  5:10264850 (GRCh38)
                  5:10264962 (GRCh37)
                  Gene:
                  CCT5 (Varview)
                  Functional Consequence:
                  3_prime_UTR_variant
                  Clinical significance:
                  benign
                  Validated:
                  by frequency,by cluster
                  MAF:
                  A=0.126667/76 (NorthernSweden)
                  A=0.134598/603 (Estonian)
                  A=0.141412/545 (ALSPAC)
                  A=0.147789/548 (TWINSUK)
                  A=0.148148/32 (Vietnamese)
                  A=0.256837/8058 (GnomAD)
                  A=0.266835/33506 (TOPMED)
                  A=0.314297/1574 (1000Genomes)
                  HGVS:
                  NC_000005.10:g.10264850A>C, NC_000005.10:g.10264850A>G, NC_000005.9:g.10264962A>C, NC_000005.9:g.10264962A>G, NG_012160.1:g.19681A>C, NG_012160.1:g.19681A>G, NM_012073.5:c.*67A>C, NM_012073.5:c.*67A>G, NM_012073.4:c.*67A>C, NM_012073.4:c.*67A>G, NM_012073.3:c.*67A>C, NM_012073.3:c.*67A>G, NM_001306154.1:c.*67A>C, NM_001306154.1:c.*67A>G, NM_001306156.1:c.*67A>C, NM_001306156.1:c.*67A>G, NM_001306155.1:c.*67A>C, NM_001306155.1:c.*67A>G, NM_001306153.1:c.*67A>C, NM_001306153.1:c.*67A>G
                  10.

                  rs551 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    G>A [Show Flanks]
                    Chromosome:
                    4:109740781 (GRCh38)
                    4:110661937 (GRCh37)
                    Gene:
                    CFI (Varview)
                    Functional Consequence:
                    genic_downstream_transcript_variant,3_prime_UTR_variant,downstream_transcript_variant,intron_variant
                    Clinical significance:
                    benign
                    Validated:
                    by frequency,by cluster
                    MAF:
                    G=0./0 (ALSPAC)
                    G=0./0 (NorthernSweden)
                    G=0./0 (TWINSUK)
                    G=0./0 (Vietnamese)
                    G=0.010723/1926 (GnomAD_exomes)
                    G=0.011832/678 (ExAC)
                    G=0.045683/1435 (GnomAD)
                    G=0.046326/232 (1000Genomes)
                    G=0.050387/6327 (TOPMED)
                    HGVS:
                    NC_000004.12:g.109740781G>A, NC_000004.11:g.110661937G>A, NG_007569.1:g.66205C>T, NM_000204.4:c.*112C>T, NM_000204.3:c.*112C>T, NM_001318057.2:c.*112C>T, NM_001318057.1:c.*112C>T, NM_001331035.2:c.*112C>T, NM_001331035.1:c.*112C>T
                    11.

                    rs553 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      G>A,T [Show Flanks]
                      Chromosome:
                      6:131890900 (GRCh38)
                      6:132212040 (GRCh37)
                      Gene:
                      ENPP1 (Varview)
                      Functional Consequence:
                      3_prime_UTR_variant
                      Clinical significance:
                      benign
                      Validated:
                      by frequency,by cluster
                      MAF:
                      A=0.028795/129 (Estonian)
                      A=0.04/24 (NorthernSweden)
                      A=0.048813/181 (TWINSUK)
                      A=0.050078/193 (ALSPAC)
                      A=0.109424/3430 (GnomAD)
                      A=0.116214/582 (1000Genomes)
                      A=0.123344/15488 (TOPMED)
                      HGVS:
                      NC_000006.12:g.131890900G>A, NC_000006.12:g.131890900G>T, NC_000006.11:g.132212040G>A, NC_000006.11:g.132212040G>T, NG_008206.1:g.87885G>A, NG_008206.1:g.87885G>T, NM_006208.3:c.*389G>A, NM_006208.3:c.*389G>T, NM_006208.2:c.*389G>A, NM_006208.2:c.*389G>T
                      12.

                      rs567 [Homo sapiens]
                        Variant type:
                        SNV
                        Alleles:
                        G>A [Show Flanks]
                        Chromosome:
                        5:53683267 (GRCh38)
                        5:52979097 (GRCh37)
                        Gene:
                        NDUFS4 (Varview)
                        Functional Consequence:
                        3_prime_UTR_variant,genic_downstream_transcript_variant,non_coding_transcript_variant
                        Clinical significance:
                        likely-benign
                        Validated:
                        by frequency,by cluster
                        MAF:
                        A=0.324074/70 (Vietnamese)
                        A=0.378594/1896 (1000Genomes)
                        A=0.379037/29414 (PAGE_STUDY)
                        A=0.388333/233 (NorthernSweden)
                        A=0.408177/51254 (TOPMED)
                        A=0.419499/5456 (GoESP)
                        A=0.420069/13149 (GnomAD)
                        A=0.448487/53491 (ExAC)
                        A=0.456542/113385 (GnomAD_exomes)
                        A=0.479502/1848 (ALSPAC)
                        A=0.479687/2149 (Estonian)
                        A=0.487325/1807 (TWINSUK)
                        HGVS:
                        NC_000005.10:g.53683267G>A, NC_000005.9:g.52979097G>A, NG_008200.1:g.127633G>A, NM_002495.4:c.*46G>A, NM_002495.3:c.*46G>A, NM_002495.2:c.*46G>A, NR_134473.1:n.776G>A, NR_134475.1:n.728G>A, NR_134474.1:n.693G>A, NM_001318051.1:c.*137G>A, NM_001318051.2:c.*137G>A
                        13.

                        rs576 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          C>T [Show Flanks]
                          Chromosome:
                          3:69967316 (GRCh38)
                          3:70016467 (GRCh37)
                          Gene:
                          MITF (Varview)
                          Functional Consequence:
                          3_prime_UTR_variant,genic_downstream_transcript_variant
                          Clinical significance:
                          benign
                          Validated:
                          by frequency,by cluster
                          MAF:
                          T=0.245283/52 (Vietnamese)
                          T=0.278857/1034 (TWINSUK)
                          T=0.291386/1123 (ALSPAC)
                          T=0.325/1456 (Estonian)
                          T=0.326667/196 (NorthernSweden)
                          T=0.336837/42296 (TOPMED)
                          T=0.336879/10545 (GnomAD)
                          T=0.341054/1708 (1000Genomes)
                          HGVS:
                          NC_000003.12:g.69967316C>T, NC_000003.11:g.70016467C>T, NG_011631.1:g.232835C>T, NM_198159.3:c.*2068C>T, NM_198159.2:c.*2068C>T, NM_198177.3:c.*2068C>T, NM_198177.2:c.*2068C>T, NM_000248.3:c.*2068C>T, NM_198158.3:c.*2068C>T, NM_198158.2:c.*2068C>T, NM_198178.3:c.*2068C>T, NM_198178.2:c.*2068C>T, NM_001354607.2:c.*2068C>T, NM_001354607.1:c.*2068C>T, NM_001354608.2:c.*2068C>T, NM_001354608.1:c.*2068C>T, NM_001354604.2:c.*2068C>T, NM_001354604.1:c.*2068C>T, NM_001354605.2:c.*2068C>T, NM_001354605.1:c.*2068C>T, NM_001354606.2:c.*2068C>T, NM_001354606.1:c.*2068C>T, NM_001184967.2:c.*2068C>T, NM_001184967.1:c.*2068C>T, NM_006722.2:c.*2068C>T
                          15.

                          rs662 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            T>C [Show Flanks]
                            Chromosome:
                            7:95308134 (GRCh38)
                            7:94937446 (GRCh37)
                            Gene:
                            PON1 (Varview)
                            Functional Consequence:
                            missense_variant,coding_sequence_variant
                            Clinical significance:
                            risk-factor,association
                            Validated:
                            by frequency,by cluster
                            MAF:
                            C=0.247991/1111 (Estonian)
                            C=0.253333/152 (NorthernSweden)
                            C=0.278857/1034 (TWINSUK)
                            C=0.290348/1119 (ALSPAC)
                            C=0.377047/45735 (ExAC)
                            C=0.378433/95101 (GnomAD_exomes)
                            C=0.407194/12746 (GnomAD)
                            C=0.439411/55176 (TOPMED)
                            T=0.294788/181 (Vietnamese)
                            T=0.428751/33741 (PAGE_STUDY)
                            T=0.457069/2289 (1000Genomes)
                            HGVS:
                            NC_000007.14:g.95308134T>C, NC_000007.13:g.94937446T>C, NG_008779.2:g.21573A>G, NM_000446.7:c.575A>G, NM_000446.6:c.575A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg
                            16.

                            rs665 [Homo sapiens]
                              Variant type:
                              SNV
                              Alleles:
                              C>T [Show Flanks]
                              Chromosome:
                              1:23854551 (GRCh38)
                              1:24181041 (GRCh37)
                              Gene:
                              FUCA1 (Varview)
                              Functional Consequence:
                              missense_variant,coding_sequence_variant
                              Clinical significance:
                              likely-benign
                              Validated:
                              by frequency,by cluster
                              MAF:
                              T=0.000429/108 (GnomAD_exomes)
                              T=0.000593/72 (ExAC)
                              T=0.000998/5 (1000Genomes)
                              T=0.002103/66 (GnomAD)
                              T=0.002214/278 (TOPMED)
                              T=0.002922/38 (GoESP)
                              T=0.002986/235 (PAGE_STUDY)
                              HGVS:
                              NC_000001.11:g.23854551C>T, NC_000001.10:g.24181041C>T, NG_013346.1:g.18819G>A, NM_000147.4:c.778G>A, XM_005245821.3:c.403G>A, XM_005245821.1:c.403G>A, XM_011541167.3:c.145G>A, XM_017000905.2:c.475G>A, NP_000138.2:p.Val260Ile, XP_005245878.1:p.Val135Ile, XP_011539469.1:p.Val49Ile, XP_016856394.1:p.Val159Ile
                              17.

                              rs669 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                T>C [Show Flanks]
                                Chromosome:
                                12:9079672 (GRCh38)
                                12:9232268 (GRCh37)
                                Gene:
                                A2M (Varview), KLRG1 (Varview)
                                Functional Consequence:
                                coding_sequence_variant,genic_downstream_transcript_variant,missense_variant,intron_variant
                                Clinical significance:
                                risk-factor,benign
                                Validated:
                                by frequency,by cluster
                                MAF:
                                C=0.096248/59 (Vietnamese)
                                C=0.254393/1274 (1000Genomes)
                                C=0.280363/22064 (PAGE_STUDY)
                                C=0.309537/38868 (TOPMED)
                                C=0.309818/77045 (GnomAD_exomes)
                                C=0.310214/37096 (ExAC)
                                C=0.337379/1251 (TWINSUK)
                                C=0.338458/10612 (GnomAD)
                                C=0.344837/1329 (ALSPAC)
                                C=0.365/219 (NorthernSweden)
                                C=0.405134/1815 (Estonian)
                                HGVS:
                                NC_000012.12:g.9079672T>C, NC_000012.11:g.9232268T>C, NG_011717.1:g.41291A>G, NM_000014.5:c.2998A>G, NM_000014.4:c.2998A>G, NM_001347423.2:c.2998A>G, NM_001347423.1:c.2998A>G, NM_001347424.1:c.2698A>G, NM_001347425.1:c.2548A>G, XM_006719056.3:c.2998A>G, NP_000005.2:p.Ile1000Val, NP_001334352.2:p.Ile1000Val, NP_001334353.1:p.Ile900Val, NP_001334354.1:p.Ile850Val, XP_006719119.1:p.Ile1000Val
                                18.

                                rs671 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  G>A [Show Flanks]
                                  Chromosome:
                                  12:111803962 (GRCh38)
                                  12:112241766 (GRCh37)
                                  Gene:
                                  ALDH2 (Varview)
                                  Functional Consequence:
                                  coding_sequence_variant,missense_variant
                                  Clinical significance:
                                  risk-factor,protective,drug-response
                                  Validated:
                                  by frequency,by cluster
                                  MAF:
                                  A=0./0 (TWINSUK)
                                  A=0.001038/4 (ALSPAC)
                                  A=0.013398/420 (GnomAD)
                                  A=0.015609/1960 (TOPMED)
                                  A=0.018882/4582 (GnomAD_exomes)
                                  A=0.021287/1878 (ExAC)
                                  A=0.027166/2138 (PAGE_STUDY)
                                  A=0.035743/179 (1000Genomes)
                                  A=0.208609/126 (Vietnamese)
                                  HGVS:
                                  NC_000012.12:g.111803962G>A, NC_000012.11:g.112241766G>A, NG_012250.1:g.42421G>A, NG_012250.2:g.42076G>A, NM_000690.3:c.1510G>A, NM_000690.4:c.1510G>A, NM_001204889.1:c.1369G>A, NM_001204889.2:c.1369G>A, NP_000681.2:p.Glu504Lys, NP_001191818.1:p.Glu457Lys
                                  19.

                                  rs674 [Homo sapiens]
                                    Variant type:
                                    SNV
                                    Alleles:
                                    G>A [Show Flanks]
                                    Chromosome:
                                    12:64716361 (GRCh38)
                                    12:65110141 (GRCh37)
                                    Gene:
                                    GNS (Varview)
                                    Functional Consequence:
                                    3_prime_UTR_variant
                                    Clinical significance:
                                    benign
                                    Validated:
                                    by frequency,by cluster
                                    MAF:
                                    G=0.117925/25 (Vietnamese)
                                    G=0.284345/1424 (1000Genomes)
                                    G=0.35281/11062 (GnomAD)
                                    G=0.36405/45713 (TOPMED)
                                    G=0.370089/1658 (Estonian)
                                    G=0.405/243 (NorthernSweden)
                                    G=0.406072/1565 (ALSPAC)
                                    G=0.413161/1532 (TWINSUK)
                                    HGVS:
                                    NC_000012.12:g.64716361G>A, NC_000012.11:g.65110141G>A, NG_008955.1:g.48086C>T, NM_002076.4:c.*380C>T, NM_002076.3:c.*380C>T
                                    20.

                                    rs678 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      A>G,T [Show Flanks]
                                      Chromosome:
                                      3:52786965 (GRCh38)
                                      3:52820981 (GRCh37)
                                      Gene:
                                      ITIH1 (Varview)
                                      Functional Consequence:
                                      missense_variant,coding_sequence_variant
                                      Clinical significance:
                                      benign
                                      Validated:
                                      by frequency,by cluster
                                      MAF:
                                      T=0.183601/103 (Vietnamese)
                                      T=0.286941/1437 (1000Genomes)
                                      T=0.3004/3907 (GoESP)
                                      T=0.309051/9643 (GnomAD)
                                      T=0.314825/39532 (TOPMED)
                                      T=0.350054/1298 (TWINSUK)
                                      T=0.352233/42268 (ExAC)
                                      T=0.354956/1368 (ALSPAC)
                                      T=0.355/213 (NorthernSweden)
                                      T=0.357867/89532 (GnomAD_exomes)
                                      T=0.391246/1752 (Estonian)
                                      HGVS:
                                      NC_000003.12:g.52786965A>G, NC_000003.12:g.52786965A>T, NC_000003.11:g.52820981A>G, NC_000003.11:g.52820981A>T, NG_016005.1:g.14374A>G, NG_016005.1:g.14374A>T, NM_002215.4:c.1754A>G, NM_002215.4:c.1754A>T, NM_002215.3:c.1754A>G, NM_002215.3:c.1754A>T, NM_001166434.2:c.1328A>G, NM_001166434.2:c.1328A>T, NM_001166434.3:c.1328A>G, NM_001166434.3:c.1328A>T, NM_001166435.2:c.890A>G, NM_001166435.2:c.890A>T, NM_001166436.2:c.890A>G, NM_001166436.2:c.890A>T, NP_002206.2:p.Glu585Gly, NP_002206.2:p.Glu585Val, NP_001159906.1:p.Glu443Gly, NP_001159906.1:p.Glu443Val, NP_001159907.1:p.Glu297Gly, NP_001159907.1:p.Glu297Val, NP_001159908.1:p.Glu297Gly, NP_001159908.1:p.Glu297Val

                                      Display Settings:

                                      Format
                                      Items per page
                                      Sort by

                                      Send to:

                                      Choose Destination

                                      Supplemental Content

                                      Find related data

                                      Search details

                                      See more...

                                      Recent activity

                                      Your browsing activity is empty.

                                      Activity recording is turned off.

                                      Turn recording back on

                                      See more...
                                      Support Center