Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 19151

1.

rs1158188 [Homo sapiens]
    ATCAGTCATGGAGGCCAAGGACAAG[C/T]AGGTGCACTGGTTGAACTACAGTAG
    Chromosome:
    15:25050993
    Gene:
    SNORD116-1 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.0629/315
    HGVS:
    NC_000015.10:g.25050993T>C, NC_000015.9:g.25296140T>C, NG_002690.1:g.270084T>C, NR_003316.1:n.-483T>C
    2.

    rs2052724 [Homo sapiens]
      ttttagtgtcacattcaaaaactta[C/T]tgacaaaaacaagaagggtttccat
      Chromosome:
      15:25049548
      Gene:
      SNORD116-1 (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      C=0.0585/293
      HGVS:
      NC_000015.10:g.25049548T>C, NC_000015.9:g.25294695T>C, NG_002690.1:g.268639T>C, NR_003316.1:n.-1928T>C
      3.

      rs2554433 [Homo sapiens]
        ACCCATGCCATTCTGTGGATACCTA[A/G]GGAACATGTGTGGCCAGAACTACTG
        Chromosome:
        15:25050919
        Gene:
        SNORD116-1 (GeneView)
        Functional Consequence:
        upstream variant 2KB
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        T=0.0054/27
        HGVS:
        NC_000015.10:g.25050919C>T, NC_000015.9:g.25296066C>T, NG_002690.1:g.270010C>T, NR_003316.1:n.-557C>T
        4.

        rs4274409 [Homo sapiens]
          TCGGACCTGGAGGCTGCAGACCATC[A/G]TGGCCCTTTGCAGTGTTCGGAAACA
          Chromosome:
          15:25050690
          Gene:
          SNORD116-1 (GeneView)
          Functional Consequence:
          upstream variant 2KB
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency
          Global MAF:
          A=0.1743/873
          HGVS:
          NC_000015.10:g.25050690G>A, NC_000015.9:g.25295837G>A, NG_002690.1:g.269781G>A, NR_003316.1:n.-786G>A
          5.

          rs4302012 [Homo sapiens]
            tatgttgtaaggtaaggattcagtt[G/T]actttttttttttaatttgcggata
            Chromosome:
            15:25049671
            Gene:
            SNORD116-1 (GeneView)
            Functional Consequence:
            upstream variant 2KB
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            G=0.0152/76
            HGVS:
            NC_000015.10:g.25049671T>G, NC_000015.9:g.25294818T>G, NG_002690.1:g.268762T>G, NR_003316.1:n.-1805T>G
            6.

            rs12102239 [Homo sapiens]
              TGCCCATTGCTCAGTGGTGCAGCTC[A/T]GGCTTCCCCAGCATGCTGAATGTCT
              Chromosome:
              15:25051383
              Gene:
              SNORD116-1 (GeneView)
              Functional Consequence:
              upstream variant 2KB
              Validated:
              by 1000G,by cluster,by frequency
              Global MAF:
              A=0.0096/48
              HGVS:
              NC_000015.10:g.25051383T>A, NC_000015.9:g.25296530T>A, NG_002690.1:g.270474T>A, NR_003316.1:n.-93T>A
              7.

              rs41286586 [Homo sapiens]
                TTAGGACGGTAAGCATTCCTCTGCC[C/G]CACGTGCTGAATGAGAGTGGCTTTT
                Chromosome:
                15:25051254
                Gene:
                SNORD116-1 (GeneView)
                Functional Consequence:
                upstream variant 2KB
                Validated:
                no info
                HGVS:
                NC_000015.10:g.25051254C>G, NC_000015.9:g.25296401C>G, NG_002690.1:g.270345C>G, NR_003316.1:n.-222C>G
                8.

                rs57317172 [Homo sapiens]
                  CACACACACACACACACACACACAC[-/AC]GCAAACTCACAAACACAACACACAG
                  Chromosome:
                  15:25050779
                  Gene:
                  SNORD116-1 (GeneView)
                  Functional Consequence:
                  upstream variant 2KB
                  Validated:
                  no info
                  HGVS:
                  NC_000015.10:g.25050779_25050780insAC, NC_000015.9:g.25295926_25295927insAC, NG_002690.1:g.269870_269871insAC, NR_003316.1:n.-697_-696insAC
                  9.

                  rs72083863 [Homo sapiens]
                    AAACATATGCGCACCCCAGGGAGGG[-/ACAC]ACACACACACACACACACACACACA
                    Chromosome:
                    15:25050736
                    Gene:
                    SNORD116-1 (GeneView)
                    Functional Consequence:
                    upstream variant 2KB
                    Validated:
                    by cluster
                    HGVS:
                    NC_000015.10:g.25050736_25050739delACAC, NC_000015.9:g.25295883_25295886delACAC, NG_002690.1:g.269827_269830delACAC, NR_003316.1:n.-740_-737delACAC
                    10.

                    rs72695335 [Homo sapiens]
                      CAGACCTTGGTGTTGATTTTTGATT[A/G]GTTGAGAACAGGGGAGTGCCAAGGT
                      Chromosome:
                      15:25051963
                      Gene:
                      SNORD116-1 (GeneView)
                      Functional Consequence:
                      downstream variant 500B
                      Validated:
                      by 1000G,by cluster,by frequency
                      Global MAF:
                      G=0.0028/14
                      HGVS:
                      NC_000015.10:g.25051963A>G, NC_000015.9:g.25297110A>G, NG_002690.1:g.271054A>G, NR_003316.1:n.488A>G
                      11.

                      rs74756662 [Homo sapiens]
                        AAGGTGTTAGGGGAGAGTGCAGAGC[A/C]ATAGGTGTCGGGGCAAACAGTGAAA
                        Chromosome:
                        15:25052009
                        Gene:
                        SNORD116-1 (GeneView)
                        Functional Consequence:
                        downstream variant 500B
                        Validated:
                        by 1000G,by frequency
                        Global MAF:
                        C=0.0030/15
                        HGVS:
                        NC_000015.10:g.25052009A>C, NC_000015.9:g.25297156A>C, NG_002690.1:g.271100A>C, NR_003316.1:n.534A>C
                        12.

                        rs74916104 [Homo sapiens]
                          GGCCGCTCTGTGATGGCGTGGTGGC[C/T]GTGGAAGCAGGCAGAAATGTTGCAG
                          Chromosome:
                          15:25051761
                          Gene:
                          SNORD116-1 (GeneView)
                          Functional Consequence:
                          downstream variant 500B
                          Validated:
                          by 1000G,by cluster,by frequency
                          Global MAF:
                          T=0.0317/159
                          HGVS:
                          NC_000015.10:g.25051761C>T, NC_000015.9:g.25296908C>T, NG_002690.1:g.270852C>T, NR_003316.1:n.286C>T
                          13.

                          rs75853283 [Homo sapiens]
                            CAATGGACCTGGGCCTGTTTCTCAA[C/G]TGTGTATTTGATTTCTTTACAATTC
                            Chromosome:
                            15:25051066
                            Gene:
                            SNORD116-1 (GeneView)
                            Functional Consequence:
                            upstream variant 2KB
                            Validated:
                            by cluster
                            HGVS:
                            NC_000015.10:g.25051066G>C, NC_000015.9:g.25296213G>C, NG_002690.1:g.270157G>C, NR_003316.1:n.-410G>C
                            14.

                            rs75854217 [Homo sapiens]
                              AATGGACCTGGGCCTGTTTCTCAAG[A/C/T]GTGTATTTGATTTCTTTACAATTCC
                              Chromosome:
                              15:25051067
                              Gene:
                              SNORD116-1 (GeneView)
                              Functional Consequence:
                              upstream variant 2KB
                              Validated:
                              by cluster,by frequency
                              HGVS:
                              NC_000015.10:g.25051067T>A, NC_000015.10:g.25051067T>C, NC_000015.9:g.25296214T>A, NC_000015.9:g.25296214T>C, NG_002690.1:g.270158T>A, NG_002690.1:g.270158T>C, NR_003316.1:n.-409T>A, NR_003316.1:n.-409T>C
                              15.

                              rs75940310 [Homo sapiens]
                                ACATTACCTTCGGATGTCCTGAGGG[C/G]ATGGTGCAGGCACCAGGACTGAGTG
                                Chromosome:
                                15:25050301
                                Gene:
                                SNORD116-1 (GeneView)
                                Functional Consequence:
                                upstream variant 2KB
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                G=0.0315/158
                                HGVS:
                                NC_000015.10:g.25050301C>G, NC_000015.9:g.25295448C>G, NG_002690.1:g.269392C>G, NR_003316.1:n.-1175C>G
                                16.

                                rs79338477 [Homo sapiens]
                                  ATGGACCTGGGCCTGTTTCTCAAGT[C/G/T]TGTATTTGATTTCTTTACAATTCCC
                                  Chromosome:
                                  15:25051068
                                  Gene:
                                  SNORD116-1 (GeneView)
                                  Functional Consequence:
                                  upstream variant 2KB
                                  Validated:
                                  by cluster,by frequency
                                  HGVS:
                                  NC_000015.10:g.25051068G>C, NC_000015.10:g.25051068G>T, NC_000015.9:g.25296215G>C, NC_000015.9:g.25296215G>T, NG_002690.1:g.270159G>C, NG_002690.1:g.270159G>T, NR_003316.1:n.-408G>C, NR_003316.1:n.-408G>T
                                  17.

                                  rs79802576 [Homo sapiens]
                                    GCAATGGACCTGGGCCTGTTTCTCA[A/C]GTGTGTATTTGATTTCTTTACAATT
                                    Chromosome:
                                    15:25051065
                                    Gene:
                                    SNORD116-1 (GeneView)
                                    Functional Consequence:
                                    upstream variant 2KB
                                    Validated:
                                    by cluster
                                    HGVS:
                                    NC_000015.10:g.25051065A>C, NC_000015.9:g.25296212A>C, NG_002690.1:g.270156A>C, NR_003316.1:n.-411A>C
                                    18.

                                    rs111238483 [Homo sapiens]
                                      CCTTTGCAGTGTTCGGAAACATATG[A/C/T]GCACCCCAGGGAGGGACACACACAC
                                      Chromosome:
                                      15:25050720
                                      Gene:
                                      SNORD116-1 (GeneView)
                                      Functional Consequence:
                                      upstream variant 2KB
                                      Validated:
                                      by 1000G,by frequency
                                      Global MAF:
                                      T=0.0008/4
                                      HGVS:
                                      NC_000015.10:g.25050720C>A, NC_000015.10:g.25050720C>T, NC_000015.9:g.25295867C>A, NC_000015.9:g.25295867C>T, NG_002690.1:g.269811C>A, NG_002690.1:g.269811C>T, NR_003316.1:n.-756C>A, NR_003316.1:n.-756C>T
                                      19.

                                      rs113070185 [Homo sapiens]
                                        GTTTTTGGCTAGGTACACCTCACCT[G/T]GGACAGTGGCCAAAGACAGTGTCAG
                                        Chromosome:
                                        15:25050479
                                        Gene:
                                        SNORD116-1 (GeneView)
                                        Functional Consequence:
                                        upstream variant 2KB
                                        Validated:
                                        no info
                                        HGVS:
                                        NC_000015.10:g.25050479G>T, NC_000015.9:g.25295626G>T, NG_002690.1:g.269570G>T, NR_003316.1:n.-997G>T
                                        20.

                                        rs113454391 [Homo sapiens]
                                          CACACAGACAGAAAATGACAAATAA[-/AC]ACACACACTCACACACACACACACA
                                          Chromosome:
                                          15:25050823
                                          Gene:
                                          SNORD116-1 (GeneView)
                                          Functional Consequence:
                                          upstream variant 2KB
                                          Validated:
                                          no info
                                          HGVS:
                                          NC_000015.10:g.25050823_25050824delAC, NC_000015.9:g.25295970_25295971delAC, NG_002690.1:g.269914_269915delAC, NR_003316.1:n.-653_-652delAC

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Search details

                                          See more...

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center