Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 92

1.

rs8156331 [Rattus norvegicus]
    CATGCTCTTTCCCTTCTGCCATGAC[C/T]GCCACGATGGTATCTACTGCAGCAG
    Chromosome:
    3:148168749
    Gene:
    Hm13 (GeneView) Mcts2 (GeneView)
    Functional Consequence:
    intron variant,synonymous codon
    Validated:
    by frequency
    2.

    rs8171753 [Rattus norvegicus]
      TTGTTTGATCCGCACGGTAACATAC[A/G]TATCTTCACAGTTATCTCTTTCAAA
      Chromosome:
      3:148167567
      Gene:
      Hm13 (GeneView) Mcts2 (GeneView)
      Functional Consequence:
      intron variant,utr variant 5 prime
      Validated:
      by frequency
      3.

      rs27372080 [Mus musculus]
        CAGGGCTTATATCTCCAGCATCCTA[C/T]ATTTTATCCCGGTTTATGTTCGCGC
        Chromosome:
        2:152688435
        Gene:
        H13 (GeneView) Mcts2 (GeneView)
        Functional Consequence:
        downstream variant 500B,intron variant
        Validated:
        by frequency
        4.

        rs27372081 [Mus musculus]
          TGATTTCCTAAAATTCTGAGCTTGG[A/T]AAGAGTACCATTACTTGGGAACTGA
          Chromosome:
          2:152688235
          Gene:
          H13 (GeneView) Mcts2 (GeneView)
          Functional Consequence:
          downstream variant 500B,intron variant
          Validated:
          by frequency
          5.

          rs27372082 [Mus musculus]
            TACCAGCAATTCCCTTGATTTCCTA[A/C]AATTCTGAGCTTGGTAAGAGTACCA
            Chromosome:
            2:152688220
            Gene:
            H13 (GeneView) Mcts2 (GeneView)
            Functional Consequence:
            downstream variant 500B,intron variant
            Validated:
            by frequency
            6.

            rs27372083 [Mus musculus]
              AGGTGCTCCTGTAAGAGCAGCCTTC[A/C/G]AGATTCCCTCTTGCCTCTTTTCTAC
              Chromosome:
              2:152688132
              Gene:
              H13 (GeneView) Mcts2 (GeneView)
              Functional Consequence:
              downstream variant 500B,intron variant
              Validated:
              by frequency
              7.

              rs27372084 [Mus musculus]
                AATCCAGAGTGGGTCTGACATCAGG[A/G]TCTCTACCAAGGTGCTCCTGTAAGA
                Chromosome:
                2:152688097
                Gene:
                H13 (GeneView) Mcts2 (GeneView)
                Functional Consequence:
                downstream variant 500B,intron variant
                Validated:
                by frequency
                8.

                rs27372085 [Mus musculus]
                  CCTGGGGCTTCCTTATTAGGAAATT[C/T]GGAAGAATCCAGAGTGGGTCTGACA
                  Chromosome:
                  2:152688066
                  Gene:
                  H13 (GeneView) Mcts2 (GeneView)
                  Functional Consequence:
                  downstream variant 500B,intron variant
                  Validated:
                  by frequency
                  9.

                  rs27372086 [Mus musculus]
                    CAAGCAGCTTGCTGCACTTTGGAGT[C/G]TGACAAAAAGTGGCCGCACTCTGGC
                    Chromosome:
                    2:152688016
                    Gene:
                    H13 (GeneView) Mcts2 (GeneView)
                    Functional Consequence:
                    downstream variant 500B,intron variant
                    Validated:
                    by frequency
                    10.

                    rs27372087 [Mus musculus]
                      GAAGTCCGGAGAGGAGCCGGAAATC[G/T]GAAGAAGAACCAGTGGGGTAATCAC
                      Chromosome:
                      2:152687034
                      Gene:
                      H13 (GeneView) Mcts2 (GeneView)
                      Functional Consequence:
                      intron variant,upstream variant 2KB
                      Validated:
                      by frequency
                      11.

                      rs27372088 [Mus musculus]
                        CCGGAAGTCCGGAGAGGAGCCGGAA[A/G]TCTGAAGAAGAACCAGTGGGGTAAT
                        Chromosome:
                        2:152687031
                        Gene:
                        H13 (GeneView) Mcts2 (GeneView)
                        Functional Consequence:
                        intron variant,upstream variant 2KB
                        Validated:
                        by frequency
                        12.

                        rs27372089 [Mus musculus]
                          CGCCGGAAGACAGACAGGAACATTC[C/T]TATTGGCCCGTTAGCTCCCGGGGGA
                          Chromosome:
                          2:152686835
                          Gene:
                          H13 (GeneView) Mcts2 (GeneView)
                          Functional Consequence:
                          intron variant,upstream variant 2KB
                          Validated:
                          by frequency
                          13.

                          rs27372090 [Mus musculus]
                            TCATGCGGATGCACACAAGGTGACA[A/G]GAGTAACGATGCCTTGGACTAAGTG
                            Chromosome:
                            2:152686575
                            Gene:
                            H13 (GeneView) Mcts2 (GeneView)
                            Functional Consequence:
                            intron variant,upstream variant 2KB,utr variant 3 prime
                            Validated:
                            by frequency
                            14.

                            rs27372091 [Mus musculus]
                              TTCACGTAAGCTTTGAAAGAGATAA[A/C]TATGAAGATACGTACGGCATCATGC
                              Chromosome:
                              2:152686530
                              Gene:
                              H13 (GeneView) Mcts2 (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB,utr variant 3 prime
                              Validated:
                              by frequency
                              15.

                              rs27372092 [Mus musculus]
                                CCCCAGTAAAAGCTGTACCAGACAG[C/T]TCTTAGCGTGCCTATCTCGTGATTG
                                Chromosome:
                                2:152686478
                                Gene:
                                H13 (GeneView) Mcts2 (GeneView)
                                Functional Consequence:
                                intron variant,upstream variant 2KB,utr variant 3 prime
                                Validated:
                                by frequency
                                16.

                                rs27372093 [Mus musculus]
                                  TGATCCCGTTGTTTCTGAGCACGGG[C/T]TGTTTTTGGAGGTTTGTTACCCCAT
                                  Chromosome:
                                  2:152686366
                                  Gene:
                                  H13 (GeneView) Mcts2 (GeneView)
                                  Functional Consequence:
                                  intron variant,synonymous codon,upstream variant 2KB
                                  Validated:
                                  by frequency
                                  17.

                                  rs27372094 [Mus musculus]
                                    AACCGAATTTGTATGGCCCTGGTTC[A/G]TACCCAGCTTGGTCACCACCTAGCA
                                    Chromosome:
                                    2:152686302
                                    Gene:
                                    H13 (GeneView) Mcts2 (GeneView)
                                    Functional Consequence:
                                    intron variant,synonymous codon,upstream variant 2KB
                                    Validated:
                                    by frequency
                                    18.

                                    rs27372095 [Mus musculus]
                                      TCCAGTACTGGGTTTTCCAAAGAAA[C/G/T]GAGCACTAAAGACGAAACCGAATTT
                                      Chromosome:
                                      2:152686261
                                      Gene:
                                      H13 (GeneView) Mcts2 (GeneView)
                                      Functional Consequence:
                                      intron variant,missense,stop gained,upstream variant 2KB
                                      Validated:
                                      by frequency
                                      19.

                                      rs27372096 [Mus musculus]
                                        AGGCACTTAAAAAGGCATCTGCAGG[A/T]AAACGGCCACAAGTAGGTGTTAGCG
                                        Chromosome:
                                        2:152686006
                                        Gene:
                                        H13 (GeneView) Mcts2 (GeneView)
                                        Functional Consequence:
                                        intron variant,upstream variant 2KB
                                        Validated:
                                        by frequency
                                        20.

                                        rs27372097 [Mus musculus]
                                          CTCATAGATCTCCACTATATTTGTA[A/T]AAGCCCAGTCGTGTTGTCTGATCAG
                                          Chromosome:
                                          2:152685686
                                          Gene:
                                          H13 (GeneView) Mcts2 (GeneView)
                                          Functional Consequence:
                                          intron variant,upstream variant 2KB
                                          Validated:
                                          by frequency

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Search details

                                          See more...

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center