Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 4592

1.

rs431825163 [Homo sapiens]
    TCTCAAACCTGCACTGAATGGGAAT[A/G]TTAATGTCTGGCCACTTAAGATTGA
    Chromosome:
    11:2001815
    Gene:
    H19 (GeneView) MRPL23 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    untested
    Validated:
    no info
    HGVS:
    NC_000011.10:g.2001815G>A, NC_000011.9:g.2023045G>A, NG_016165.1:g.1021C>T, NR_131224.1:n.-349C>T, XM_011520273.1:c.498-9726G>A, XM_011520275.2:c.498-9726G>A
    2.

    rs431825164 [Homo sapiens]
      TGGCTCGTACAAGGGTCCTACCCCC[A/G]ATGACCCTCGCGAACCAATGCGGTG
      Chromosome:
      11:2001083
      Gene:
      H19 (GeneView) MRPL23 (GeneView)
      Functional Consequence:
      intron variant
      Allele Origin:
      G(germline)/A(germline,unknown)
      Clinical significance:
      untested
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0010/5
      HGVS:
      NC_000011.10:g.2001083G>A, NC_000011.9:g.2022313G>A, NG_016165.1:g.1753C>T, NR_131224.1:n.249+135C>T, XM_011520273.1:c.498-10458G>A, XM_011520275.2:c.498-10458G>A
      3.

      rs431825165 [Homo sapiens]
        AAGCAGCAGTGGCACTCCCAGCTCT[
        -/TTAGCATCTCAAGCTCCTAAA
        ]TTAGCATCTCAAACCTGCACTGAAT
        Chromosome:
        11:2001763
        Gene:
        H19 (GeneView) MRPL23 (GeneView)
        Functional Consequence:
        intron variant,upstream variant 2KB
        Clinical significance:
        untested
        Validated:
        no info
        HGVS:
        NC_000011.10:g.2001763_2001783del21, NC_000011.9:g.2022993_2023013del21, NG_016165.1:g.1053_1073del21, NR_131224.1:n.-317_-297del, NR_131224.1:n.-317_-297del21, XM_011520273.1:c.498-9778_498-9758del, XM_011520273.1:c.498-9778_498-9758del21, XM_011520275.2:c.498-9778_498-9758del, XM_011520275.2:c.498-9778_498-9758del21
        4.

        rs431825166 [Homo sapiens]
          CCCGTGAACCCTGCGGCGCCTGGCT[A/T]GCGGGACCCGGGACGTTTCCGCGGG
          Chromosome:
          11:2000708
          Gene:
          H19 (GeneView) MRPL23 (GeneView)
          Functional Consequence:
          intron variant
          Allele Origin:
          T(germline)/A(germline)
          Clinical significance:
          untested
          Validated:
          no info
          HGVS:
          NC_000011.10:g.2000708T>A, NC_000011.9:g.2021938T>A, NG_016165.1:g.2128A>T, NR_131224.1:n.249+510A>T, XM_011520273.1:c.498-10833T>A, XM_011520275.2:c.498-10833T>A
          5.

          rs431825167 [Homo sapiens]
            GGCTCTGTGCCTGCCAGAGACCCTG[A/C]GAGAAGGGTTTCACACTAGGGCCGA
            Chromosome:
            11:2000108
            Gene:
            H19 (GeneView) MRPL23 (GeneView)
            Functional Consequence:
            intron variant
            Allele Origin:
            A(germline)/C(germline)
            Clinical significance:
            untested
            Validated:
            no info
            HGVS:
            NC_000011.10:g.2000108C>A, NC_000011.9:g.2021338C>A, NG_016165.1:g.2728G>T, NR_131224.1:n.249+1110G>T, XM_011520273.1:c.498-11433C>A, XM_011520275.2:c.498-11433C>A
            6.

            rs431825168 [Homo sapiens]
              TCTCCCCAACCTTCAACAGTGCACC[A/C]TGGGGTGAATCAGGCACGTAGCCCG
              Chromosome:
              11:2001029
              Gene:
              H19 (GeneView) MRPL23 (GeneView)
              Functional Consequence:
              intron variant
              Allele Origin:
              A(germline)/C(germline)
              Clinical significance:
              untested
              Validated:
              no info
              HGVS:
              NC_000011.10:g.2001029C>A, NC_000011.9:g.2022259C>A, NG_016165.1:g.1807G>T, NR_131224.1:n.249+189G>T, XM_011520273.1:c.498-10512C>A, XM_011520275.2:c.498-10512C>A
              7.

              rs431825169 [Homo sapiens]
                CCAAGTATCTCCTCTCATCTCCCCA[A/T]CCCTCAATAGTGCACCCTGGGGTGA
                Chromosome:
                11:2000605
                Gene:
                H19 (GeneView) MRPL23 (GeneView)
                Functional Consequence:
                intron variant
                Allele Origin:
                T(germline)/A(germline)
                Clinical significance:
                untested
                Validated:
                no info
                HGVS:
                NC_000011.10:g.2000605A>T, NC_000011.9:g.2021835A>T, NG_016165.1:g.2231T>A, NR_131224.1:n.249+613T>A, XM_011520273.1:c.498-10936A>T, XM_011520275.2:c.498-10936A>T
                8.

                rs483353061 [Homo sapiens]
                  CAACAGTGCACCCTGGGGTGAATCA[A/G]ACACGTAGCCCGATATGGCTCCCAT
                  Chromosome:
                  11:2000229
                  Gene:
                  H19 (GeneView) MRPL23 (GeneView)
                  Functional Consequence:
                  intron variant
                  Allele Origin:
                  G(germline)/A(germline)
                  Clinical significance:
                  untested
                  Validated:
                  no info
                  HGVS:
                  NC_000011.10:g.2000229G>A, NC_000011.9:g.2021459G>A, NG_016165.1:g.2607C>T, NR_131224.1:n.249+989C>T, XM_011520273.1:c.498-11312G>A, XM_011520275.2:c.498-11312G>A
                  9.

                  rs483353062 [Homo sapiens]
                    AGCCCCTGGGCTCTTGAGCCTGCCA[A/G]AGACCCTGTGGGAGGGGTCTCACGC
                    Chromosome:
                    11:2000912
                    Gene:
                    H19 (GeneView) MRPL23 (GeneView)
                    Functional Consequence:
                    intron variant
                    Allele Origin:
                    G(germline)/A(germline)
                    Clinical significance:
                    untested
                    Validated:
                    no info
                    HGVS:
                    NC_000011.10:g.2000912G>A, NC_000011.9:g.2022142G>A, NG_016165.1:g.1924C>T, NR_131224.1:n.249+306C>T, XM_011520273.1:c.498-10629G>A, XM_011520275.2:c.498-10629G>A
                    10.

                    rs587777745 [Homo sapiens]
                      GCTAATTTAGGAGCTTGAGATGCTA[A/C]AGAGCTGGGAGTGCCACTGCTGCTT
                      Chromosome:
                      11:2001763
                      Gene:
                      H19 (GeneView) MRPL23 (GeneView)
                      Functional Consequence:
                      intron variant,upstream variant 2KB
                      Allele Origin:
                      A(germline)/C(germline)
                      Clinical significance:
                      untested
                      Validated:
                      no info
                      HGVS:
                      NC_000011.10:g.2001763T>G, NC_000011.9:g.2022993T>G, NG_016165.1:g.1073A>C, NR_131224.1:n.-297A>C, XM_011520273.1:c.498-9778T>G, XM_011520275.2:c.498-9778T>G
                      11.

                      rs217727 [Homo sapiens]
                        CCATCTTCATGGCCACCCCCTGCGG[C/T]GGACGGTTGACCACCAGCCACCACA
                        Chromosome:
                        11:1995678
                        Gene:
                        H19 (GeneView) HOTS (GeneView) MRPL23 (GeneView)
                        Functional Consequence:
                        intron variant,nc transcript variant,utr variant 3 prime
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                        Global MAF:
                        A=0.2021/1012
                        HGVS:
                        NC_000011.10:g.1995678G>A, NC_000011.9:g.2016908G>A, NG_016165.1:g.7158C>T, NG_045220.1:g.8271G>A, NM_001293171.2:c.*26G>A, NR_002196.2:n.1846C>T, NR_131223.1:n.1840C>T, NR_131224.1:n.737C>T, XM_011520273.1:c.498-15863G>A, XM_011520275.2:c.498-15863G>A
                        12.

                        rs2067051 [Homo sapiens]
                          AGTGCTCGGGGAGTTGCAGCAGGAC[A/G]TCACCAGGAGGGCGAAGCGGCCACG
                          Chromosome:
                          11:1996938
                          Gene:
                          H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                          Functional Consequence:
                          intron variant,nc transcript variant,upstream variant 2KB
                          Validated:
                          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                          Global MAF:
                          T=0.2863/1434
                          HGVS:
                          NC_000011.10:g.1996938C>T, NC_000011.9:g.2018168C>T, NG_016165.1:g.5898G>A, NG_045220.1:g.9531C>T, NR_002196.2:n.938G>A, NR_030533.1:n.-107G>A, NR_131223.1:n.938G>A, NR_131224.1:n.250-517G>A, XM_011520273.1:c.498-14603C>T, XM_011520275.2:c.498-14603C>T
                          13.

                          rs2071094 [Homo sapiens]
                            CACACATCACAGCCCGAGCCCGCCC[A/C]AACTGGGGTTCGCCCGTGGAAACGT
                            Chromosome:
                            11:1999934
                            Gene:
                            H19 (GeneView) MRPL23 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by cluster,by frequency,by hapmap
                            Global MAF:
                            T=0.2915/1460
                            HGVS:
                            NC_000011.10:g.1999934G>T, NC_000011.9:g.2021164G>T, NG_016165.1:g.2902C>A, NR_131224.1:n.249+1284C>A, XM_011520273.1:c.498-11607G>T, XM_011520275.2:c.498-11607G>T
                            14.

                            rs2071095 [Homo sapiens]
                              CCTGCGGCTTGTGGACTCGGTACGG[G/T]GTGGGGATCCTGATGGGGTTAGGAT
                              Chromosome:
                              11:1999397
                              Gene:
                              H19 (GeneView) MRPL23 (GeneView)
                              Functional Consequence:
                              intron variant,upstream variant 2KB
                              Validated:
                              by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                              Global MAF:
                              A=0.2919/1462
                              HGVS:
                              NC_000011.10:g.1999397C>A, NC_000011.9:g.2020627C>A, NG_016165.1:g.3439G>T, NR_002196.2:n.-1522G>T, NR_131223.1:n.-1522G>T, NR_131224.1:n.249+1821G>T, XM_011520273.1:c.498-12144C>A, XM_011520275.2:c.498-12144C>A
                              15.

                              rs2075744 [Homo sapiens]
                                GCCGAGACTGCGCAAGGCTGGGGGG[C/T]TATGGGCCCGTTCCAGGCAGAAAGA
                                Chromosome:
                                11:1997219
                                Gene:
                                H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                                Functional Consequence:
                                intron variant,nc transcript variant,upstream variant 2KB
                                Validated:
                                by 1000G,by cluster,by frequency
                                Global MAF:
                                G=0.2935/1470
                                HGVS:
                                NC_000011.10:g.1997219A>G, NC_000011.9:g.2018449A>G, NG_016165.1:g.5617T>C, NG_045220.1:g.9812A>G, NR_002196.2:n.657T>C, NR_030533.1:n.-388T>C, NR_131223.1:n.657T>C, NR_131224.1:n.250-798T>C, XM_011520273.1:c.498-14322A>G, XM_011520275.2:c.498-14322A>G
                                17.

                                rs2107425 [Homo sapiens]
                                  CGACCTGAAGATCTGGTGCGGCTCC[C/T]ATGAGTGTCCTATTCCCAGATGACC
                                  Chromosome:
                                  11:1999845
                                  Gene:
                                  H19 (GeneView) MRPL23 (GeneView)
                                  Functional Consequence:
                                  intron variant,upstream variant 2KB
                                  Validated:
                                  by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                  Global MAF:
                                  T=0.4479/2243
                                  HGVS:
                                  NC_000011.10:g.1999845C>T, NC_000011.9:g.2021075C>T, NG_016165.1:g.2991G>A, NR_002196.2:n.-1970G>A, NR_131223.1:n.-1970G>A, NR_131224.1:n.249+1373G>A, XM_011520273.1:c.498-11696C>T, XM_011520275.2:c.498-11696C>T
                                  18.

                                  rs2158394 [Homo sapiens]
                                    ACCCAGAGTTCACGGGTCCAATCAC[C/G]CAGCAGGCCCTCTGGGATGTGGAAG
                                    Chromosome:
                                    11:1998765
                                    Gene:
                                    H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                                    Functional Consequence:
                                    intron variant,upstream variant 2KB
                                    Validated:
                                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                                    Global MAF:
                                    G=0.3578/1792
                                    HGVS:
                                    NC_000011.10:g.1998765C>G, NC_000011.9:g.2019995C>G, NG_016165.1:g.4071G>C, NR_002196.2:n.-890G>C, NR_030533.1:n.-1934G>C, NR_131223.1:n.-890G>C, NR_131224.1:n.250-2344G>C, XM_011520273.1:c.498-12776C>G, XM_011520275.2:c.498-12776C>G
                                    19.

                                    rs2251312 [Homo sapiens]
                                      TCTGTCCTGCGGAAACCGCGGTGAC[C/G]AGCACAAGCTCGGTCAACTGGATGG
                                      Chromosome:
                                      11:1998388
                                      Gene:
                                      H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                                      Functional Consequence:
                                      intron variant,upstream variant 2KB
                                      Validated:
                                      by 1000G,by cluster,by frequency,by hapmap
                                      Global MAF:
                                      G=0.1358/680
                                      HGVS:
                                      NC_000011.10:g.1998388G>C, NC_000011.9:g.2019618G>C, NG_016165.1:g.4448C>G, NR_002196.2:n.-513C>G, NR_030533.1:n.-1557C>G, NR_131223.1:n.-513C>G, NR_131224.1:n.250-1967C>G, XM_011520273.1:c.498-13153G>C, XM_011520275.2:c.498-13153G>C
                                      20.

                                      rs2251375 [Homo sapiens]
                                        CTTCCTGCCACCATCACGGCTCAGA[A/C]CTCACGTTCCTGGAGAGTAGGGGTG
                                        Chromosome:
                                        11:1998266
                                        Gene:
                                        H19 (GeneView) MIR675 (GeneView) MRPL23 (GeneView)
                                        Functional Consequence:
                                        intron variant,upstream variant 2KB
                                        Validated:
                                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                                        Global MAF:
                                        A=0.4806/2407
                                        HGVS:
                                        NC_000011.10:g.1998266C>A, NC_000011.9:g.2019496C>A, NG_016165.1:g.4570G>T, NG_045220.1:g.10859C>A, NR_002196.2:n.-391G>T, NR_030533.1:n.-1435G>T, NR_131223.1:n.-391G>T, NR_131224.1:n.250-1845G>T, XM_011520273.1:c.498-13275C>A, XM_011520275.2:c.498-13275C>A

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Search details

                                        See more...

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center