Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 32807

1.

rs10863 [Homo sapiens]
    CAGAGTAGTGAAGCTAATTAAACAC[A/G]TTTGGTTTCTGAATAAATTGAACTA
    Chromosome:
    7:130505748
    Gene:
    COPG2 (GeneView) MEST (GeneView)
    Functional Consequence:
    intron variant,utr variant 3 prime
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2404/1204
    HGVS:
    NC_000007.13:g.130145589A>G, NC_000007.14:g.130505748A>G, NG_009226.1:g.24544A>G, NM_001253900.1:c.*692A>G, NM_001253901.1:c.*692A>G, NM_001253902.1:c.*692A>G, NM_002402.3:c.*692A>G, NM_012133.5:c.*438+490T>C, NM_177524.2:c.*692A>G, NM_177525.2:c.*692A>G, NW_003871065.1:g.161166A>G, XM_005250352.1:c.*692A>G, XM_005277629.1:c.*692A>G, XM_011516222.1:c.*692A>G, XM_017012218.1:c.*692A>G
    2.

    rs2072575 [Homo sapiens]
      CAGCTAAAGGAGCCTGCAACTGGAG[A/G]AGAAGGGAGGCAAACCTGCATCAGT
      Chromosome:
      7:130508666
      Gene:
      COPG2 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.4167/2087
      HGVS:
      NC_000007.13:g.130148507G>A, NC_000007.14:g.130508666G>A, NM_012133.5:c.2150-7C>T
      3.

      rs2129905 [Homo sapiens]
        CAAGTTATGTGCTGCTAAAATACTG[C/T]GGTGGGACAGGCATAGAATAACAAT
        Chromosome:
        7:130620608
        Gene:
        COPG2 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by cluster,by frequency,by hapmap
        Global MAF:
        G=0.4149/2078
        HGVS:
        NC_000007.13:g.130305479A>G, NC_000007.14:g.130620608A>G, NM_001290033.1:c.324-3543T>C, NM_012133.5:c.324-3543T>C
        4.

        rs3173907 has merged into rs10863 [Homo sapiens]
          CAGAGTAGTGAAGCTAATTAAACAC[A/G]TTTGGTTTCTGAATAAATTGAACTA
          Chromosome:
          7:130505748
          Gene:
          COPG2 (GeneView) MEST (GeneView)
          Functional Consequence:
          intron variant,utr variant 3 prime
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.2404/1204
          HGVS:
          NC_000007.13:g.130145589A>G, NC_000007.14:g.130505748A>G, NG_009226.1:g.24544A>G, NM_001253900.1:c.*692A>G, NM_001253901.1:c.*692A>G, NM_001253902.1:c.*692A>G, NM_002402.3:c.*692A>G, NM_012133.5:c.*438+490T>C, NM_177524.2:c.*692A>G, NM_177525.2:c.*692A>G, NW_003871065.1:g.161166A>G, XM_005250352.1:c.*692A>G, XM_005277629.1:c.*692A>G, XM_011516222.1:c.*692A>G, XM_017012218.1:c.*692A>G
          5.

          rs10342244 has merged into rs10863 [Homo sapiens]
            CAGAGTAGTGAAGCTAATTAAACAC[A/G]TTTGGTTTCTGAATAAATTGAACTA
            Chromosome:
            7:130505748
            Gene:
            COPG2 (GeneView) MEST (GeneView)
            Functional Consequence:
            intron variant,utr variant 3 prime
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.2404/1204
            HGVS:
            NC_000007.13:g.130145589A>G, NC_000007.14:g.130505748A>G, NG_009226.1:g.24544A>G, NM_001253900.1:c.*692A>G, NM_001253901.1:c.*692A>G, NM_001253902.1:c.*692A>G, NM_002402.3:c.*692A>G, NM_012133.5:c.*438+490T>C, NM_177524.2:c.*692A>G, NM_177525.2:c.*692A>G, NW_003871065.1:g.161166A>G, XM_005250352.1:c.*692A>G, XM_005277629.1:c.*692A>G, XM_011516222.1:c.*692A>G, XM_017012218.1:c.*692A>G
            6.

            rs11542336 has merged into rs10863 [Homo sapiens]
              CAGAGTAGTGAAGCTAATTAAACAC[A/G]TTTGGTTTCTGAATAAATTGAACTA
              Chromosome:
              7:130505748
              Gene:
              COPG2 (GeneView) MEST (GeneView)
              Functional Consequence:
              intron variant,utr variant 3 prime
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              A=0.2404/1204
              HGVS:
              NC_000007.13:g.130145589A>G, NC_000007.14:g.130505748A>G, NG_009226.1:g.24544A>G, NM_001253900.1:c.*692A>G, NM_001253901.1:c.*692A>G, NM_001253902.1:c.*692A>G, NM_002402.3:c.*692A>G, NM_012133.5:c.*438+490T>C, NM_177524.2:c.*692A>G, NM_177525.2:c.*692A>G, NW_003871065.1:g.161166A>G, XM_005250352.1:c.*692A>G, XM_005277629.1:c.*692A>G, XM_011516222.1:c.*692A>G, XM_017012218.1:c.*692A>G
              7.

              rs11551233 has merged into rs2072575 [Homo sapiens]
                CAGCTAAAGGAGCCTGCAACTGGAG[A/G]AGAAGGGAGGCAAACCTGCATCAGT
                Chromosome:
                7:130508666
                Gene:
                COPG2 (GeneView)
                Functional Consequence:
                intron variant
                Validated:
                by 1000G,by cluster,by frequency,by hapmap,by submitter
                Global MAF:
                A=0.4167/2087
                HGVS:
                NC_000007.13:g.130148507G>A, NC_000007.14:g.130508666G>A, NM_012133.5:c.2150-7C>T
                8.

                rs17164997 has merged into rs10863 [Homo sapiens]
                  CAGAGTAGTGAAGCTAATTAAACAC[A/G]TTTGGTTTCTGAATAAATTGAACTA
                  Chromosome:
                  7:130505748
                  Gene:
                  COPG2 (GeneView) MEST (GeneView)
                  Functional Consequence:
                  intron variant,utr variant 3 prime
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap
                  Global MAF:
                  A=0.2404/1204
                  HGVS:
                  NC_000007.13:g.130145589A>G, NC_000007.14:g.130505748A>G, NG_009226.1:g.24544A>G, NM_001253900.1:c.*692A>G, NM_001253901.1:c.*692A>G, NM_001253902.1:c.*692A>G, NM_002402.3:c.*692A>G, NM_012133.5:c.*438+490T>C, NM_177524.2:c.*692A>G, NM_177525.2:c.*692A>G, NW_003871065.1:g.161166A>G, XM_005250352.1:c.*692A>G, XM_005277629.1:c.*692A>G, XM_011516222.1:c.*692A>G, XM_017012218.1:c.*692A>G
                  9.

                  rs17332858 has merged into rs2072575 [Homo sapiens]
                    CAGCTAAAGGAGCCTGCAACTGGAG[A/G]AGAAGGGAGGCAAACCTGCATCAGT
                    Chromosome:
                    7:130508666
                    Gene:
                    COPG2 (GeneView)
                    Functional Consequence:
                    intron variant
                    Validated:
                    by 1000G,by cluster,by frequency,by hapmap,by submitter
                    Global MAF:
                    A=0.4167/2087
                    HGVS:
                    NC_000007.13:g.130148507G>A, NC_000007.14:g.130508666G>A, NM_012133.5:c.2150-7C>T
                    10.

                    rs52791472 has merged into rs2072575 [Homo sapiens]
                      CAGCTAAAGGAGCCTGCAACTGGAG[A/G]AGAAGGGAGGCAAACCTGCATCAGT
                      Chromosome:
                      7:130508666
                      Gene:
                      COPG2 (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      A=0.4167/2087
                      HGVS:
                      NC_000007.13:g.130148507G>A, NC_000007.14:g.130508666G>A, NM_012133.5:c.2150-7C>T
                      11.

                      rs57184689 has merged into rs10863 [Homo sapiens]
                        CAGAGTAGTGAAGCTAATTAAACAC[A/G]TTTGGTTTCTGAATAAATTGAACTA
                        Chromosome:
                        7:130505748
                        Gene:
                        COPG2 (GeneView) MEST (GeneView)
                        Functional Consequence:
                        intron variant,utr variant 3 prime
                        Validated:
                        by 1000G,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.2404/1204
                        HGVS:
                        NC_000007.13:g.130145589A>G, NC_000007.14:g.130505748A>G, NG_009226.1:g.24544A>G, NM_001253900.1:c.*692A>G, NM_001253901.1:c.*692A>G, NM_001253902.1:c.*692A>G, NM_002402.3:c.*692A>G, NM_012133.5:c.*438+490T>C, NM_177524.2:c.*692A>G, NM_177525.2:c.*692A>G, NW_003871065.1:g.161166A>G, XM_005250352.1:c.*692A>G, XM_005277629.1:c.*692A>G, XM_011516222.1:c.*692A>G, XM_017012218.1:c.*692A>G
                        12.

                        rs58155268 has merged into rs10863 [Homo sapiens]
                          CAGAGTAGTGAAGCTAATTAAACAC[A/G]TTTGGTTTCTGAATAAATTGAACTA
                          Chromosome:
                          7:130505748
                          Gene:
                          COPG2 (GeneView) MEST (GeneView)
                          Functional Consequence:
                          intron variant,utr variant 3 prime
                          Validated:
                          by 1000G,by cluster,by frequency,by hapmap
                          Global MAF:
                          A=0.2404/1204
                          HGVS:
                          NC_000007.13:g.130145589A>G, NC_000007.14:g.130505748A>G, NG_009226.1:g.24544A>G, NM_001253900.1:c.*692A>G, NM_001253901.1:c.*692A>G, NM_001253902.1:c.*692A>G, NM_002402.3:c.*692A>G, NM_012133.5:c.*438+490T>C, NM_177524.2:c.*692A>G, NM_177525.2:c.*692A>G, NW_003871065.1:g.161166A>G, XM_005250352.1:c.*692A>G, XM_005277629.1:c.*692A>G, XM_011516222.1:c.*692A>G, XM_017012218.1:c.*692A>G
                          13.

                          rs1814 [Homo sapiens]
                            TTTCCATTATTAACTGAAGAAACAT[A/G]GGTGCTCTTTAGAGATTTTTTTCAA
                            Chromosome:
                            7:130645623
                            Gene:
                            COPG2 (GeneView)
                            Functional Consequence:
                            intron variant
                            Validated:
                            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                            Global MAF:
                            A=0.1641/822
                            HGVS:
                            NC_000007.13:g.130330493G>A, NC_000007.14:g.130645623G>A, NM_001290033.1:c.323+7246C>T, NM_012133.5:c.323+7246C>T
                            14.
                            15.

                            rs10128 [Homo sapiens]
                              GCAGCAGCAGACTAGCTCTTAAAGC[G/T]TTTGAGGGAATGGCTAATTAAAGGA
                              Chromosome:
                              7:130511853
                              Gene:
                              COPG2 (GeneView)
                              Functional Consequence:
                              intron variant
                              Validated:
                              by 1000G,by cluster,by frequency,by hapmap,by submitter
                              Global MAF:
                              G=0.1428/715
                              HGVS:
                              NC_000007.13:g.130151694T>G, NC_000007.14:g.130511853T>G, NM_012133.5:c.2150-3194A>C
                              16.

                              rs158679 [Homo sapiens]
                                tttgggaagtgtatttggatctctt[G/T]gtatctctcctattttatgctttat
                                Chromosome:
                                7:130654956
                                Gene:
                                COPG2 (GeneView)
                                Functional Consequence:
                                intron variant
                                Validated:
                                by hapmap
                                HGVS:
                                NC_000007.13:g.130339796T>G, NC_000007.14:g.130654956T>G, NM_001290033.1:c.244-2008A>C, NM_012133.5:c.244-2008A>C
                                17.

                                rs158680 [Homo sapiens]
                                  TTAAATTATTTGAAGTGAGGACCCC[A/C]AGTAGATATATATTTTAGAAAGATA
                                  Chromosome:
                                  7:130653025
                                  Gene:
                                  COPG2 (GeneView)
                                  Functional Consequence:
                                  intron variant
                                  Validated:
                                  by hapmap
                                  HGVS:
                                  NC_000007.13:g.130337865A>C, NC_000007.14:g.130653025A>C, NM_001290033.1:c.244-77T>G, NM_012133.5:c.244-77T>G
                                  18.

                                  rs158681 [Homo sapiens]
                                    ATTCTTTAAAAGAGTCTCATCTACC[A/C]AAAAAAAAAATTAATATCTGGGTGA
                                    Chromosome:
                                    7:130653075
                                    Gene:
                                    COPG2 (GeneView)
                                    Functional Consequence:
                                    intron variant
                                    Validated:
                                    by hapmap
                                    HGVS:
                                    NC_000007.13:g.130337915A>C, NC_000007.14:g.130653075A>C, NM_001290033.1:c.244-127T>G, NM_012133.5:c.244-127T>G
                                    19.

                                    rs158682 [Homo sapiens]
                                      GCTCTCACCTGTAATTCCAGCACTT[G/T]GGGAGGCTGAGATGAGAGGACTGCT
                                      Chromosome:
                                      7:130641097
                                      Gene:
                                      COPG2 (GeneView)
                                      Functional Consequence:
                                      intron variant
                                      Validated:
                                      by 1000G,by cluster,by hapmap
                                      Global MAF:
                                      G=?/0
                                      HGVS:
                                      NC_000007.13:g.130325966G>T, NC_000007.14:g.130641097T>G, NM_001290033.1:c.323+11772A>C, NM_001290033.1:c.323+11772C>A, NM_012133.5:c.323+11772A>C, NM_012133.5:c.323+11772C>A
                                      20.

                                      rs184112 [Homo sapiens]
                                        TTAGCTTACGGGTTTATTTATATTG[G/T]TAATTTTTTCAAAAATAGGATTTTG
                                        Chromosome:
                                        7:130625715
                                        Gene:
                                        COPG2 (GeneView)
                                        Functional Consequence:
                                        intron variant
                                        Validated:
                                        by hapmap
                                        HGVS:
                                        NC_000007.13:g.130310585T>G, NC_000007.14:g.130625715T>G, NM_001290033.1:c.324-8650A>C, NM_012133.5:c.324-8650A>C

                                        Display Settings:

                                        Format
                                        Items per page
                                        Sort by

                                        Send to:

                                        Choose Destination

                                        Supplemental Content

                                        Find related data

                                        Search details

                                        See more...

                                        Recent activity

                                        Your browsing activity is empty.

                                        Activity recording is turned off.

                                        Turn recording back on

                                        See more...
                                        Support Center