Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 1 to 20 of 4249915

1.

rs45003083 [Apis mellifera]
    GAAAACTTACACGCGAGAGAAATTT[C/T]CATTTTCTTTATTCGTTTCTCAAAT
    Chromosome:
    LG8:7591476
    Gene:
    LOC102654521 (GeneView) LOC551663 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    2.

    rs21784921 [Apis mellifera]
      CTAAGTAAACTTGGGGAAAGATTAG[C/T]GATTAGAATTATTTCAGCCATTCTA
      Validated:
      no info
      3.

      rs21784922 [Apis mellifera]
        AGCCATTCTATTTTCCGGATCCCGG[C/G]AACTGGGTTATTCTCATTCCCGTTA
        Validated:
        no info
        4.

        rs21785098 [Apis mellifera]
          TCCCCCTCCGCCCGCCTCTTCCCCC[A/T]CCGCTCACTGCCAATTTGGCGCAGC
          Validated:
          no info
          5.

          rs21785155 [Apis mellifera]
            CTCTGCTGTGAAACCGTTTACGAAG[A/G]CTGAGACGAAACTCGGTGGTAATCG
            Validated:
            no info
            6.

            rs21785320 [Apis mellifera]
              TCTTTCTGTGGAAAAAAAAATTCGA[C/T]CATTTTTTCGAATGGAAAAATAAAA
              Validated:
              no info
              7.

              rs21785321 [Apis mellifera]
                AAAAATTCGACCATTTTTTCGAATG[A/G]AAAAATAAAAGATCCCTTTGAAAAA
                Validated:
                no info
                8.

                rs21785564 [Apis mellifera]
                  ATTTTTTCCCTAGATTTCTCACAGA[A/G]TTATAAGAAGAGTTAAAAGGAATAT
                  Validated:
                  no info
                  9.

                  rs21785565 [Apis mellifera]
                    CTCAGTTTCTTTCCCTCTTAATTTT[C/T]ACACACTGATCCACTCTTTTTTCTT
                    Validated:
                    no info
                    10.

                    rs21785574 [Apis mellifera]
                      ATCTAACAACAGCTAACGTATCGTT[A/T]AAACGATTTAAATAATAATATTTGT
                      Validated:
                      no info
                      11.

                      rs21785575 [Apis mellifera]
                        AACGGATTAAATTTTTGTTAACGTA[A/G]TCTTTGAAAACGGTGCTAAAATACG
                        Validated:
                        no info
                        12.

                        rs21785576 [Apis mellifera]
                          GATTCATTCCAGGCAACGCGATAGG[A/G]TTTTGAAGAAAAACGCTTTGAGGGA
                          Validated:
                          no info
                          13.

                          rs21785577 [Apis mellifera]
                            GATAGGGTTTTGAAGAAAAACGCTT[C/T]GAGGGACGCGGAAGAACGGGAAGCA
                            Validated:
                            no info
                            14.

                            rs21785578 [Apis mellifera]
                              GGCGGACGAATCGAAACGGATAGGT[A/C]CCCGAGTAACTTGGATCCATCGGGG
                              Validated:
                              no info
                              15.

                              rs21785579 [Apis mellifera]
                                TGATGTCATACGATGTTAGGATCAT[A/C]GCAATGACAACAAAGGAATTTACGT
                                Validated:
                                no info
                                16.

                                rs21786193 [Apis mellifera]
                                  ACCATTGGACCGTTCTGTCCAACTT[C/T]TGTCCAATTTTCGAAAGTTAGAATT
                                  Validated:
                                  no info
                                  17.

                                  rs21786567 [Apis mellifera]
                                    AACTGTCTTTATAAAAATGTTTTTG[A/T]CTTCCTTCGTAATATTTTGTTTCGA
                                    Validated:
                                    no info
                                    18.

                                    rs21786568 [Apis mellifera]
                                      TGTCTTTATAAAAATGTTTTTGACT[C/T]CCTTCGTAATATTTTGTTTCGACCT
                                      Validated:
                                      no info
                                      19.

                                      rs21786569 [Apis mellifera]
                                        TTCGATTCGATCGATTCTACTTTTT[C/T]CGAAGGAAATAAAAGAACCATGAAT
                                        Validated:
                                        no info
                                        20.

                                        rs21786570 [Apis mellifera]
                                          AACAATGTCAAGCGTGAATATATCC[A/G]TTGCGCAAGCGCAATGATAGAAAGC
                                          Validated:
                                          no info

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Search details

                                          See more...

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center