Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 10

1.

rs35574083 [Homo sapiens]
    Variant type:
    DELINS
    Alleles:
    GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
    Chromosome:
    1:55039894 (GRCh38)
    1:55505567 (GRCh37)
    Canonical SPDI:
    NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
    Gene:
    PCSK9 (Varview)
    Functional Consequence:
    genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
    Clinical significance:
    benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
    Validated:
    by frequency,by alfa,by cluster
    MAF:
    CTGCTGCTGCTGCTGCT=0./0 (ALFA)
    CTG=0.09579/428 (Estonian)
    CTG=0.09813/21 (Vietnamese)
    HGVS:
    NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
    2.

    rs1437988217 has merged into rs35574083 [Homo sapiens]
      Variant type:
      DELINS
      Alleles:
      GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
      Chromosome:
      1:55039894 (GRCh38)
      1:55505567 (GRCh37)
      Canonical SPDI:
      NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
      Gene:
      PCSK9 (Varview)
      Functional Consequence:
      genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
      Clinical significance:
      benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
      Validated:
      by frequency,by alfa,by cluster
      MAF:
      CTGCTGCTGCTGCTGCT=0./0 (ALFA)
      CTG=0.09579/428 (Estonian)
      CTG=0.09813/21 (Vietnamese)
      HGVS:
      NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
      3.

      rs886039838 has merged into rs35574083 [Homo sapiens]
        Variant type:
        DELINS
        Alleles:
        GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
        Chromosome:
        1:55039894 (GRCh38)
        1:55505567 (GRCh37)
        Canonical SPDI:
        NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
        Gene:
        PCSK9 (Varview)
        Functional Consequence:
        genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
        Clinical significance:
        benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
        Validated:
        by frequency,by alfa,by cluster
        MAF:
        CTGCTGCTGCTGCTGCT=0./0 (ALFA)
        CTG=0.09579/428 (Estonian)
        CTG=0.09813/21 (Vietnamese)
        HGVS:
        NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
        4.

        rs778382130 has merged into rs35574083 [Homo sapiens]
          Variant type:
          DELINS
          Alleles:
          GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
          Chromosome:
          1:55039894 (GRCh38)
          1:55505567 (GRCh37)
          Canonical SPDI:
          NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
          Gene:
          PCSK9 (Varview)
          Functional Consequence:
          genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
          Clinical significance:
          benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
          Validated:
          by frequency,by alfa,by cluster
          MAF:
          CTGCTGCTGCTGCTGCT=0./0 (ALFA)
          CTG=0.09579/428 (Estonian)
          CTG=0.09813/21 (Vietnamese)
          HGVS:
          NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
          5.

          rs751675284 has merged into rs35574083 [Homo sapiens]
            Variant type:
            DELINS
            Alleles:
            GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
            Chromosome:
            1:55039894 (GRCh38)
            1:55505567 (GRCh37)
            Canonical SPDI:
            NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
            Gene:
            PCSK9 (Varview)
            Functional Consequence:
            genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
            Clinical significance:
            benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
            Validated:
            by frequency,by alfa,by cluster
            MAF:
            CTGCTGCTGCTGCTGCT=0./0 (ALFA)
            CTG=0.09579/428 (Estonian)
            CTG=0.09813/21 (Vietnamese)
            HGVS:
            NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
            6.

            rs113330492 has merged into rs35574083 [Homo sapiens]
              Variant type:
              DELINS
              Alleles:
              GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
              Chromosome:
              1:55039894 (GRCh38)
              1:55505567 (GRCh37)
              Canonical SPDI:
              NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
              Gene:
              PCSK9 (Varview)
              Functional Consequence:
              genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
              Clinical significance:
              benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
              Validated:
              by frequency,by alfa,by cluster
              MAF:
              CTGCTGCTGCTGCTGCT=0./0 (ALFA)
              CTG=0.09579/428 (Estonian)
              CTG=0.09813/21 (Vietnamese)
              HGVS:
              NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
              7.

              rs72555377 has merged into rs35574083 [Homo sapiens]
                Variant type:
                DELINS
                Alleles:
                GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
                Chromosome:
                1:55039894 (GRCh38)
                1:55505567 (GRCh37)
                Canonical SPDI:
                NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
                Gene:
                PCSK9 (Varview)
                Functional Consequence:
                genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
                Clinical significance:
                benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
                Validated:
                by frequency,by alfa,by cluster
                MAF:
                CTGCTGCTGCTGCTGCT=0./0 (ALFA)
                CTG=0.09579/428 (Estonian)
                CTG=0.09813/21 (Vietnamese)
                HGVS:
                NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
                8.

                rs45454392 has merged into rs35574083 [Homo sapiens]
                  Variant type:
                  DELINS
                  Alleles:
                  GCTGCTGCT>-,GCT,GCTGCT,GCTGCTGCTGCT,GCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCT,GCTGCTGCTGCTGCTGCTGCTGCT [Show Flanks]
                  Chromosome:
                  1:55039894 (GRCh38)
                  1:55505567 (GRCh37)
                  Canonical SPDI:
                  NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT,NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
                  Gene:
                  PCSK9 (Varview)
                  Functional Consequence:
                  genic_upstream_transcript_variant,inframe_deletion,coding_sequence_variant,inframe_insertion,upstream_transcript_variant
                  Clinical significance:
                  benign-likely-benign,uncertain-significance,conflicting-interpretations-of-pathogenicity,benign,likely-benign
                  Validated:
                  by frequency,by alfa,by cluster
                  MAF:
                  CTGCTGCTGCTGCTGCT=0./0 (ALFA)
                  CTG=0.09579/428 (Estonian)
                  CTG=0.09813/21 (Vietnamese)
                  HGVS:
                  NC_000001.11:g.55039882GCT[4], NC_000001.11:g.55039882GCT[5], NC_000001.11:g.55039882GCT[6], NC_000001.11:g.55039882GCT[8], NC_000001.11:g.55039882GCT[9], NC_000001.11:g.55039882GCT[10], NC_000001.11:g.55039882GCT[11], NC_000001.11:g.55039882GCT[12], NC_000001.10:g.55505555GCT[4], NC_000001.10:g.55505555GCT[5], NC_000001.10:g.55505555GCT[6], NC_000001.10:g.55505555GCT[8], NC_000001.10:g.55505555GCT[9], NC_000001.10:g.55505555GCT[10], NC_000001.10:g.55505555GCT[11], NC_000001.10:g.55505555GCT[12], NG_009061.1:g.5336GCT[4], NG_009061.1:g.5336GCT[5], NG_009061.1:g.5336GCT[6], NG_009061.1:g.5336GCT[8], NG_009061.1:g.5336GCT[9], NG_009061.1:g.5336GCT[10], NG_009061.1:g.5336GCT[11], NG_009061.1:g.5336GCT[12], NM_174936.4:c.45GCT[4], NM_174936.4:c.45GCT[5], NM_174936.4:c.45GCT[6], NM_174936.4:c.45GCT[8], NM_174936.4:c.45GCT[9], NM_174936.4:c.45GCT[10], NM_174936.4:c.45GCT[11], NM_174936.4:c.45GCT[12], NM_174936.3:c.45GCT[4], NM_174936.3:c.45GCT[5], NM_174936.3:c.45GCT[6], NM_174936.3:c.45GCT[8], NM_174936.3:c.45GCT[9], NM_174936.3:c.45GCT[10], NM_174936.3:c.45GCT[11], NM_174936.3:c.45GCT[12], NP_777596.2:p.Leu21_Leu23del, NP_777596.2:p.Leu22_Leu23del, NP_777596.2:p.Leu23del, NP_777596.2:p.Leu23dup, NP_777596.2:p.Leu22_Leu23dup, NP_777596.2:p.Leu21_Leu23dup, NP_777596.2:p.Leu20_Leu23dup, NP_777596.2:p.Leu19_Leu23dup
                  9.

                  rs371488778 [Homo sapiens]
                    Variant type:
                    INS
                    Alleles:
                    ->ATGCTG,TG [Show Flanks]
                    Chromosome:
                    1:55039879 (GRCh38)
                    1:55505553 (GRCh37)
                    Canonical SPDI:
                    NC_000001.11:55039879::ATGCTG,NC_000001.11:55039879::TG
                    Gene:
                    PCSK9 (Varview)
                    Functional Consequence:
                    upstream_transcript_variant,coding_sequence_variant,frameshift_variant,inframe_insertion,genic_upstream_transcript_variant
                    Validated:
                    by frequency,by alfa,by cluster
                    MAF:
                    ATGCTG=0./0 (ALFA)
                    ATGCTG=0.000014/2 (GnomAD)
                    HGVS:
                    10.

                    rs1321287784 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      C>T [Show Flanks]
                      Chromosome:
                      1:55039880 (GRCh38)
                      1:55505553 (GRCh37)
                      Canonical SPDI:
                      NC_000001.11:55039879:C:T
                      Gene:
                      PCSK9 (Varview)
                      Functional Consequence:
                      upstream_transcript_variant,genic_upstream_transcript_variant,synonymous_variant,coding_sequence_variant
                      HGVS:

                      Display Settings:

                      Format
                      Items per page
                      Sort by

                      Send to:

                      Choose Destination

                      Supplemental Content

                      Find related data

                      Search details

                      See more...

                      Recent activity

                      Your browsing activity is empty.

                      Activity recording is turned off.

                      Turn recording back on

                      See more...
                      Support Center