Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Protein

Items: 1 to 20 of 481

1.

rs780759163 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    A>G [Show Flanks]
    Chromosome:
    11:5226678
    Gene:
    HBB (Varview)
    Functional Consequence:
    coding_sequence_variant,missense_variant
    Validated:
    by frequency,by cluster
    MAF:
    G=0.0000/1 (ExAC)
    G=0.0000/1 (GnomAD_exomes)
    HGVS:
    NC_000011.10:g.5226678A>G, NC_000011.9:g.5247908A>G, NG_000007.3:g.70938T>C, NG_059281.1:g.5394T>C, NM_000518.5:c.214T>C, NM_000518.4:c.214T>C, NG_046672.1:g.4613A>G, NG_053049.1:g.2999A>G, NG_042296.1:g.209A>G, NP_000509.1:p.Phe72Leu
    2.

    rs780307221 [Homo sapiens]
      Variant type:
      SNV
      Alleles:
      G>A [Show Flanks]
      Chromosome:
      11:5225670
      Gene:
      HBB (Varview)
      Functional Consequence:
      coding_sequence_variant,synonymous_variant
      Validated:
      by frequency,by cluster
      MAF:
      A=0.0000/1 (ExAC)
      A=0.0000/1 (GnomAD_exomes)
      A=0.0000/1 (TOPMED)
      HGVS:
      NC_000011.10:g.5225670G>A, NC_000011.9:g.5246900G>A, NG_000007.3:g.71946C>T, NG_059281.1:g.6402C>T, NM_000518.5:c.372C>T, NM_000518.4:c.372C>T, NG_046672.1:g.3605G>A, NG_053049.1:g.1991G>A
      3.

      rs778841729 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        C>A,T [Show Flanks]
        Chromosome:
        11:5226796
        Gene:
        HBB (Varview)
        Functional Consequence:
        coding_sequence_variant,synonymous_variant
        Validated:
        by frequency,by cluster
        MAF:
        A=0.0000/1 (ExAC)
        A=0.0000/2 (GnomAD_exomes)
        T=0.0000/1 (GnomAD)
        HGVS:
        NC_000011.10:g.5226796C>A, NC_000011.10:g.5226796C>T, NC_000011.9:g.5248026C>A, NC_000011.9:g.5248026C>T, NG_000007.3:g.70820G>T, NG_000007.3:g.70820G>A, NG_059281.1:g.5276G>T, NG_059281.1:g.5276G>A, NM_000518.5:c.96G>T, NM_000518.5:c.96G>A, NM_000518.4:c.96G>T, NM_000518.4:c.96G>A, NG_046672.1:g.4731C>A, NG_046672.1:g.4731C>T, NG_042296.1:g.327C>A, NG_042296.1:g.327C>T
        4.

        rs777218911 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          C>T [Show Flanks]
          Chromosome:
          11:5225628
          Gene:
          HBB (Varview)
          Functional Consequence:
          coding_sequence_variant,synonymous_variant
          Validated:
          by frequency,by cluster
          MAF:
          T=0.0000/1 (ExAC)
          T=0.0000/2 (GnomAD_exomes)
          HGVS:
          NC_000011.10:g.5225628C>T, NC_000011.9:g.5246858C>T, NG_000007.3:g.71988G>A, NG_059281.1:g.6444G>A, NM_000518.5:c.414G>A, NM_000518.4:c.414G>A, NG_046672.1:g.3563C>T, NG_053049.1:g.1949C>T
          5.

          rs777114006 [Homo sapiens]
            Variant type:
            SNV
            Alleles:
            A>G [Show Flanks]
            Chromosome:
            11:5226733
            Gene:
            HBB (Varview)
            Functional Consequence:
            coding_sequence_variant,synonymous_variant
            Validated:
            by frequency,by cluster
            MAF:
            G=0.0000/1 (ExAC)
            G=0.0000/1 (GnomAD_exomes)
            G=0.0000/2 (TOPMED)
            HGVS:
            NC_000011.10:g.5226733A>G, NC_000011.9:g.5247963A>G, NG_000007.3:g.70883T>C, NG_059281.1:g.5339T>C, NM_000518.5:c.159T>C, NM_000518.4:c.159T>C, NG_046672.1:g.4668A>G, NG_042296.1:g.264A>G
            6.

            rs775936922 [Homo sapiens]
              Variant type:
              DELINS
              Alleles:
              TG>TGCTTTATG [Show Flanks]
              Chromosome:
              11:5226659
              Gene:
              HBB (Varview)
              Functional Consequence:
              coding_sequence_variant,frameshift
              Validated:
              by frequency
              MAF:
              TGCTTTA=0.0000/2 (ExAC)
              HGVS:
              NC_000011.10:g.5226660_5226661insCTTTATG, NC_000011.9:g.5247890_5247891insCTTTATG, NG_000007.3:g.70957_70958insTAAAGCA, NG_059281.1:g.5413_5414insTAAAGCA, NM_000518.5:c.233_234insTAAAGCA, NM_000518.4:c.233_234insTAAAGCA, NG_046672.1:g.4595_4596insCTTTATG, NG_053049.1:g.2981_2982insCTTTATG, NG_042296.1:g.191_192insCTTTATG, NP_000509.1:p.Leu79fs
              7.

              rs773202162 has merged into rs193922563 [Homo sapiens]
                Variant type:
                DELINS
                Alleles:
                AGCCTAAGGGTGGGAAAATAGACCAA>A,AGCCTAAGGGTGGGAAAATAGACCAAGCCTAAGGGTGGGAAAATAGACCAA [Show Flanks]
                Chromosome:
                11:5226797
                Gene:
                HBB (Varview)
                Functional Consequence:
                coding_sequence_variant,intron_variant,splice_acceptor_variant
                Clinical significance:
                pathogenic
                Validated:
                by cluster
                HGVS:
                NC_000011.10:g.5226798_5226822del, NC_000011.10:g.5226798_5226822dup, NC_000011.9:g.5248028_5248052del, NC_000011.9:g.5248028_5248052dup, NG_000007.3:g.70795_70819del, NG_000007.3:g.70795_70819dup, NG_059281.1:g.5251_5275del, NG_059281.1:g.5251_5275dup, NG_046672.1:g.4733_4757del, NG_046672.1:g.4733_4757dup, NG_042296.1:g.329_353del, NG_042296.1:g.329_353dup
                8.

                rs770878031 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  A>G [Show Flanks]
                  Chromosome:
                  11:5226703
                  Gene:
                  HBB (Varview)
                  Functional Consequence:
                  coding_sequence_variant,synonymous_variant
                  Validated:
                  by frequency,by cluster
                  MAF:
                  G=0.0000/1 (ExAC)
                  G=0.0000/1 (GnomAD_exomes)
                  HGVS:
                  NC_000011.10:g.5226703A>G, NC_000011.9:g.5247933A>G, NG_000007.3:g.70913T>C, NG_059281.1:g.5369T>C, NM_000518.5:c.189T>C, NM_000518.4:c.189T>C, NG_046672.1:g.4638A>G, NG_042296.1:g.234A>G
                  9.

                  rs770567827 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    A>C [Show Flanks]
                    Chromosome:
                    11:5225631
                    Gene:
                    HBB (Varview)
                    Functional Consequence:
                    coding_sequence_variant,synonymous_variant
                    Validated:
                    by frequency,by cluster
                    MAF:
                    C=0.0002/21 (ExAC)
                    HGVS:
                    NC_000011.10:g.5225631A>C, NC_000011.9:g.5246861A>C, NG_000007.3:g.71985T>G, NG_059281.1:g.6441T>G, NM_000518.5:c.411T>G, NM_000518.4:c.411T>G, NG_046672.1:g.3566A>C, NG_053049.1:g.1952A>C
                    10.

                    rs769583496 [Homo sapiens]
                      Variant type:
                      SNV
                      Alleles:
                      G>A [Show Flanks]
                      Chromosome:
                      11:5226618
                      Gene:
                      HBB (Varview)
                      Functional Consequence:
                      coding_sequence_variant,synonymous_variant
                      Clinical significance:
                      uncertain-significance
                      Validated:
                      by frequency,by cluster
                      MAF:
                      A=0.0000/2 (TOPMED)
                      A=0.0000/5 (ExAC)
                      A=0.0000/6 (GnomAD_exomes)
                      HGVS:
                      NC_000011.10:g.5226618G>A, NC_000011.9:g.5247848G>A, NG_000007.3:g.70998C>T, NG_059281.1:g.5454C>T, NM_000518.5:c.274C>T, NM_000518.4:c.274C>T, NG_046672.1:g.4553G>A, NG_053049.1:g.2939G>A, NG_042296.1:g.149G>A
                      11.

                      rs768336186 [Homo sapiens]
                        Variant type:
                        SNV
                        Alleles:
                        A>C,G [Show Flanks]
                        Chromosome:
                        11:5226589
                        Gene:
                        HBB (Varview)
                        Functional Consequence:
                        synonymous_variant,coding_sequence_variant
                        Validated:
                        by frequency,by cluster
                        MAF:
                        G=0.0000/1 (ExAC)
                        G=0.0000/1 (TOPMED)
                        HGVS:
                        NC_000011.10:g.5226589A>C, NC_000011.10:g.5226589A>G, NC_000011.9:g.5247819A>C, NC_000011.9:g.5247819A>G, NG_000007.3:g.71027T>G, NG_000007.3:g.71027T>C, NG_059281.1:g.5483T>G, NG_059281.1:g.5483T>C, NM_000518.5:c.303T>G, NM_000518.5:c.303T>C, NM_000518.4:c.303T>G, NM_000518.4:c.303T>C, NG_046672.1:g.4524A>C, NG_046672.1:g.4524A>G, NG_053049.1:g.2910A>C, NG_053049.1:g.2910A>G, NG_042296.1:g.120A>C, NG_042296.1:g.120A>G
                        12.

                        rs766266418 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          C>A [Show Flanks]
                          Chromosome:
                          11:5226982
                          Gene:
                          HBB (Varview)
                          Functional Consequence:
                          missense_variant,coding_sequence_variant
                          Validated:
                          by frequency,by cluster
                          MAF:
                          A=0.0000/1 (ExAC)
                          A=0.0000/1 (GnomAD_exomes)
                          HGVS:
                          NC_000011.10:g.5226982C>A, NC_000011.9:g.5248212C>A, NG_000007.3:g.70634G>T, NG_059281.1:g.5090G>T, NM_000518.5:c.40G>T, NM_000518.4:c.40G>T, NG_046672.1:g.4917C>A, NG_042296.1:g.513C>A, NP_000509.1:p.Ala14Ser
                          13.

                          rs764542454 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            G>A [Show Flanks]
                            Chromosome:
                            11:5226652
                            Gene:
                            HBB (Varview)
                            Functional Consequence:
                            synonymous_variant,coding_sequence_variant
                            Validated:
                            by frequency,by cluster
                            MAF:
                            A=0.0000/2 (GnomAD_exomes)
                            A=0.0000/3 (ExAC)
                            HGVS:
                            NC_000011.10:g.5226652G>A, NC_000011.9:g.5247882G>A, NG_000007.3:g.70964C>T, NG_059281.1:g.5420C>T, NM_000518.5:c.240C>T, NM_000518.4:c.240C>T, NG_046672.1:g.4587G>A, NG_053049.1:g.2973G>A, NG_042296.1:g.183G>A
                            14.

                            rs762782573 [Homo sapiens]
                              Variant type:
                              SNV
                              Alleles:
                              C>T [Show Flanks]
                              Chromosome:
                              11:5226977
                              Gene:
                              HBB (Varview)
                              Functional Consequence:
                              synonymous_variant,coding_sequence_variant
                              Clinical significance:
                              conflicting-interpretations-of-pathogenicity
                              Validated:
                              by frequency,by cluster
                              MAF:
                              T=0.0000/3 (TOPMED)
                              T=0.0000/4 (ExAC)
                              T=0.0000/7 (GnomAD_exomes)
                              HGVS:
                              NC_000011.10:g.5226977C>T, NC_000011.9:g.5248207C>T, NG_000007.3:g.70639G>A, NG_059281.1:g.5095G>A, NM_000518.5:c.45G>A, NM_000518.4:c.45G>A, NG_046672.1:g.4912C>T, NG_042296.1:g.508C>T
                              15.

                              rs762111851 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                A>G,T [Show Flanks]
                                Chromosome:
                                11:5226736
                                Gene:
                                HBB (Varview)
                                Functional Consequence:
                                synonymous_variant,coding_sequence_variant
                                Validated:
                                by frequency,by cluster
                                MAF:
                                G=0.0000/2 (ExAC)
                                G=0.0000/4 (GnomAD_exomes)
                                HGVS:
                                NC_000011.10:g.5226736A>G, NC_000011.10:g.5226736A>T, NC_000011.9:g.5247966A>G, NC_000011.9:g.5247966A>T, NG_000007.3:g.70880T>C, NG_000007.3:g.70880T>A, NG_059281.1:g.5336T>C, NG_059281.1:g.5336T>A, NM_000518.5:c.156T>C, NM_000518.5:c.156T>A, NM_000518.4:c.156T>C, NM_000518.4:c.156T>A, NG_046672.1:g.4671A>G, NG_046672.1:g.4671A>T, NG_042296.1:g.267A>G, NG_042296.1:g.267A>T
                                16.

                                rs760975738 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  A>G [Show Flanks]
                                  Chromosome:
                                  11:5226727
                                  Gene:
                                  HBB (Varview)
                                  Functional Consequence:
                                  synonymous_variant,coding_sequence_variant
                                  Validated:
                                  by frequency,by cluster
                                  MAF:
                                  G=0.0000/2 (ExAC)
                                  G=0.0000/3 (TOPMED)
                                  G=0.0000/4 (GnomAD_exomes)
                                  HGVS:
                                  NC_000011.10:g.5226727A>G, NC_000011.9:g.5247957A>G, NG_000007.3:g.70889T>C, NG_059281.1:g.5345T>C, NM_000518.5:c.165T>C, NM_000518.4:c.165T>C, NG_046672.1:g.4662A>G, NG_042296.1:g.258A>G
                                  17.

                                  rs758591462 [Homo sapiens]
                                    Variant type:
                                    SNV
                                    Alleles:
                                    G>C [Show Flanks]
                                    Chromosome:
                                    11:5225666
                                    Gene:
                                    HBB (Varview)
                                    Functional Consequence:
                                    missense_variant,coding_sequence_variant
                                    Validated:
                                    by frequency,by cluster
                                    MAF:
                                    C=0.0000/1 (ExAC)
                                    C=0.0000/1 (GnomAD_exomes)
                                    HGVS:
                                    NC_000011.10:g.5225666G>C, NC_000011.9:g.5246896G>C, NG_000007.3:g.71950C>G, NG_059281.1:g.6406C>G, NM_000518.5:c.376C>G, NM_000518.4:c.376C>G, NG_046672.1:g.3601G>C, NG_053049.1:g.1987G>C, NP_000509.1:p.Pro126Ala
                                    18.

                                    rs756416304 [Homo sapiens]
                                      Variant type:
                                      DELINS
                                      Alleles:
                                      AGC>AGCCTGAAGTTCTCAGGATCCACGTGCAGCTTGTCACAGTGCAGC [Show Flanks]
                                      Chromosome:
                                      11:5225725
                                      Gene:
                                      HBB (Varview)
                                      Functional Consequence:
                                      splice_acceptor_variant,coding_sequence_variant
                                      Validated:
                                      by frequency
                                      MAF:
                                      AGCCTGAAGTTCTCAGGATCCACGTGCAGCTTGTCACAGTGC=0.0000/1 (ExAC)
                                      HGVS:
                                      NC_000011.10:g.5225727_5225728insCTGAAGTTCTCAGGATCCACGTGCAGCTTGTCACAGTGCAGC, NC_000011.9:g.5246957_5246958insCTGAAGTTCTCAGGATCCACGTGCAGCTTGTCACAGTGCAGC, NG_000007.3:g.71891_71892insGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCT, NG_059281.1:g.6347_6348insGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCT, NG_046672.1:g.3662_3663insCTGAAGTTCTCAGGATCCACGTGCAGCTTGTCACAGTGCAGC, NG_053049.1:g.2048_2049insCTGAAGTTCTCAGGATCCACGTGCAGCTTGTCACAGTGCAGC
                                      19.

                                      rs754481448 [Homo sapiens]
                                        Variant type:
                                        SNV
                                        Alleles:
                                        A>G [Show Flanks]
                                        Chromosome:
                                        11:5226676
                                        Gene:
                                        HBB (Varview)
                                        Functional Consequence:
                                        synonymous_variant,coding_sequence_variant
                                        Validated:
                                        by frequency,by cluster
                                        MAF:
                                        G=0.0000/1 (ExAC)
                                        G=0.0000/1 (GnomAD_exomes)
                                        HGVS:
                                        NC_000011.10:g.5226676A>G, NC_000011.9:g.5247906A>G, NG_000007.3:g.70940T>C, NG_059281.1:g.5396T>C, NM_000518.5:c.216T>C, NM_000518.4:c.216T>C, NG_046672.1:g.4611A>G, NG_053049.1:g.2997A>G, NG_042296.1:g.207A>G
                                        20.

                                        rs754454495 [Homo sapiens]
                                          Variant type:
                                          SNV
                                          Alleles:
                                          A>G [Show Flanks]
                                          Chromosome:
                                          11:5226748
                                          Gene:
                                          HBB (Varview)
                                          Functional Consequence:
                                          synonymous_variant,coding_sequence_variant
                                          Clinical significance:
                                          uncertain-significance
                                          Validated:
                                          by frequency,by cluster
                                          MAF:
                                          G=0.0000/1 (ExAC)
                                          G=0.0000/3 (GnomAD_exomes)
                                          HGVS:
                                          NC_000011.10:g.5226748A>G, NC_000011.9:g.5247978A>G, NG_000007.3:g.70868T>C, NG_059281.1:g.5324T>C, NM_000518.5:c.144T>C, NM_000518.4:c.144T>C, NG_046672.1:g.4683A>G, NG_042296.1:g.279A>G

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center