Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from Gene

Items: 1 to 20 of 3255

1.

rs1490863113 [Homo sapiens]
    Variant type:
    SNV
    Alleles:
    G>A
    Chromosome:
    7:37917332
    Gene:
    SFRP4 (GeneView)
    Functional Consequence:
    upstream_transcript_variant
    Validated:
    by frequency,by cluster
    Global MAF:
    A=0.0000/1 (GnomAD)
    A=0.0000/2 (TOPMED)
    HGVS:
    NC_000007.14:g.37917332G>A, NC_000007.13:g.37956934G>A, NG_052980.1:g.4592C>T
    2.

    rs1490804200 [Homo sapiens]
      Variant type:
      DEL
      Alleles:
      T>-
      Chromosome:
      7:37905524
      Gene:
      SFRP4 (GeneView)
      Functional Consequence:
      downstream_transcript_variant
      HGVS:
      NC_000007.14:g.37905524delT, NC_000007.13:g.37945126delT, NG_052980.1:g.16400delA
      3.

      rs1489684603 [Homo sapiens]
        Variant type:
        SNV
        Alleles:
        A>G
        Chromosome:
        7:37912925
        Gene:
        SFRP4 (GeneView)
        Functional Consequence:
        intron_variant
        Validated:
        by frequency
        Global MAF:
        G=0.0000/1 (GnomAD)
        G=0.0002/1 (Estonian)
        HGVS:
        NC_000007.14:g.37912925A>G, NC_000007.13:g.37952527A>G, NG_052980.1:g.8999T>C
        4.

        rs1489644101 [Homo sapiens]
          Variant type:
          SNV
          Alleles:
          C>A
          Chromosome:
          7:37918658
          Gene:
          EPDR1 (GeneView), SFRP4 (GeneView)
          Functional Consequence:
          upstream_transcript_variant
          Validated:
          by frequency
          Global MAF:
          A=0.0000/1 (GnomAD)
          HGVS:
          NC_000007.14:g.37918658C>A, NC_000007.13:g.37958260C>A, NG_052980.1:g.3266G>T
          5.

          rs1489504196 [Homo sapiens]
            Variant type:
            SNV
            Alleles:
            C>T
            Chromosome:
            7:37908016
            Gene:
            SFRP4 (GeneView)
            Functional Consequence:
            intron_variant
            Validated:
            by frequency
            Global MAF:
            T=0.0000/1 (TOPMED)
            HGVS:
            NC_000007.14:g.37908016C>T, NC_000007.13:g.37947618C>T, NG_052980.1:g.13908G>A
            6.

            rs1489180697 [Homo sapiens]
              Variant type:
              SNV
              Alleles:
              G>A
              Chromosome:
              7:37918571
              Gene:
              EPDR1 (GeneView), SFRP4 (GeneView)
              Functional Consequence:
              upstream_transcript_variant
              Validated:
              by frequency
              Global MAF:
              A=0.0000/4 (TOPMED)
              HGVS:
              NC_000007.14:g.37918571G>A, NC_000007.13:g.37958173G>A, NG_052980.1:g.3353C>T
              7.

              rs1489040952 [Homo sapiens]
                Variant type:
                SNV
                Alleles:
                G>C
                Chromosome:
                7:37914089
                Gene:
                SFRP4 (GeneView)
                Functional Consequence:
                intron_variant
                HGVS:
                NC_000007.14:g.37914089G>C, NC_000007.13:g.37953691G>C, NG_052980.1:g.7835C>G
                8.

                rs1488847783 [Homo sapiens]
                  Variant type:
                  SNV
                  Alleles:
                  C>G
                  Chromosome:
                  7:37914721
                  Gene:
                  SFRP4 (GeneView)
                  Functional Consequence:
                  intron_variant
                  Validated:
                  by frequency
                  Global MAF:
                  G=0.0000/1 (TOPMED)
                  HGVS:
                  NC_000007.14:g.37914721C>G, NC_000007.13:g.37954323C>G, NG_052980.1:g.7203G>C
                  9.

                  rs1488814149 [Homo sapiens]
                    Variant type:
                    SNV
                    Alleles:
                    G>A
                    Chromosome:
                    7:37916267
                    Gene:
                    SFRP4 (GeneView)
                    Functional Consequence:
                    missense_variant,coding_sequence_variant
                    Validated:
                    by frequency
                    Global MAF:
                    A=0.0000/1 (GnomAD_exomes)
                    HGVS:
                    NC_000007.14:g.37916267G>A, NC_000007.13:g.37955869G>A, NG_052980.1:g.5657C>T, NM_003014.3:c.271C>T, NP_003005.2:p.His91Tyr
                    10.

                    rs1488646332 [Homo sapiens]
                      Variant type:
                      DELINS
                      Alleles:
                      AAGAA>AA
                      Chromosome:
                      7:37911497
                      Gene:
                      SFRP4 (GeneView)
                      Functional Consequence:
                      intron_variant
                      HGVS:
                      NC_000007.14:g.37911499_37911501delGAA, NC_000007.13:g.37951101_37951103delGAA, NG_052980.1:g.10425_10427delCTT
                      11.

                      rs1488347666 [Homo sapiens]
                        Variant type:
                        DEL
                        Alleles:
                        T>-
                        Chromosome:
                        7:37905492
                        Gene:
                        SFRP4 (GeneView)
                        Functional Consequence:
                        downstream_transcript_variant
                        HGVS:
                        NC_000007.14:g.37905492delT, NC_000007.13:g.37945094delT, NG_052980.1:g.16432delA
                        12.

                        rs1487411428 [Homo sapiens]
                          Variant type:
                          SNV
                          Alleles:
                          A>G
                          Chromosome:
                          7:37913202
                          Gene:
                          SFRP4 (GeneView)
                          Functional Consequence:
                          intron_variant
                          Validated:
                          by frequency,by cluster
                          Global MAF:
                          G=0.0000/6 (TOPMED)
                          G=0.0002/5 (GnomAD)
                          HGVS:
                          NC_000007.14:g.37913202A>G, NC_000007.13:g.37952804A>G, NG_052980.1:g.8722T>C
                          13.

                          rs1487377054 [Homo sapiens]
                            Variant type:
                            SNV
                            Alleles:
                            T>G
                            Chromosome:
                            7:37905587
                            Gene:
                            SFRP4 (GeneView)
                            Functional Consequence:
                            downstream_transcript_variant
                            Validated:
                            by frequency
                            Global MAF:
                            G=0.0000/1 (TOPMED)
                            HGVS:
                            NC_000007.14:g.37905587T>G, NC_000007.13:g.37945189T>G, NG_052980.1:g.16337A>C
                            14.

                            rs1487368179 has merged into rs71558103 [Homo sapiens]
                              Variant type:
                              DELINS
                              Alleles:
                              TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC>TCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC,TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC
                              Chromosome:
                              7:37905435
                              Gene:
                              SFRP4 (GeneView)
                              Functional Consequence:
                              downstream_transcript_variant
                              Validated:
                              by cluster
                              HGVS:
                              NC_000007.14:g.37905437_37905440TATC[5], NC_000007.14:g.37905437_37905440TATC[6], NC_000007.14:g.37905437_37905440TATC[7], NC_000007.14:g.37905437_37905440TATC[8], NC_000007.14:g.37905437_37905440TATC[9], NC_000007.14:g.37905437_37905440TATC[10], NC_000007.14:g.37905437_37905440TATC[11], NC_000007.14:g.37905437_37905440TATC[12], NC_000007.14:g.37905437_37905440TATC[14], NC_000007.13:g.37945039_37945042TATC[5], NC_000007.13:g.37945039_37945042TATC[6], NC_000007.13:g.37945039_37945042TATC[7], NC_000007.13:g.37945039_37945042TATC[8], NC_000007.13:g.37945039_37945042TATC[9], NC_000007.13:g.37945039_37945042TATC[10], NC_000007.13:g.37945039_37945042TATC[11], NC_000007.13:g.37945039_37945042TATC[12], NC_000007.13:g.37945039_37945042TATC[14], NG_052980.1:g.16438_16441TAGA[5], NG_052980.1:g.16438_16441TAGA[6], NG_052980.1:g.16438_16441TAGA[7], NG_052980.1:g.16438_16441TAGA[8], NG_052980.1:g.16438_16441TAGA[9], NG_052980.1:g.16438_16441TAGA[10], NG_052980.1:g.16438_16441TAGA[11], NG_052980.1:g.16438_16441TAGA[12], NG_052980.1:g.16438_16441TAGA[14]
                              15.

                              rs1487260594 [Homo sapiens]
                                Variant type:
                                SNV
                                Alleles:
                                C>T
                                Chromosome:
                                7:37916677
                                Gene:
                                SFRP4 (GeneView)
                                Functional Consequence:
                                5_prime_UTR_variant
                                Validated:
                                by frequency
                                Global MAF:
                                T=0.0000/5 (TOPMED)
                                HGVS:
                                NC_000007.14:g.37916677C>T, NC_000007.13:g.37956279C>T, NG_052980.1:g.5247G>A, NM_003014.3:c.-140G>A
                                16.

                                rs1487230370 [Homo sapiens]
                                  Variant type:
                                  SNV
                                  Alleles:
                                  T>G
                                  Chromosome:
                                  7:37917475
                                  Gene:
                                  SFRP4 (GeneView)
                                  Functional Consequence:
                                  upstream_transcript_variant
                                  Validated:
                                  by frequency
                                  Global MAF:
                                  G=0.0000/2 (TOPMED)
                                  HGVS:
                                  NC_000007.14:g.37917475T>G, NC_000007.13:g.37957077T>G, NG_052980.1:g.4449A>C
                                  17.

                                  rs1486710871 [Homo sapiens]
                                    Variant type:
                                    DEL
                                    Alleles:
                                    G>-
                                    Chromosome:
                                    7:37916419
                                    Gene:
                                    SFRP4 (GeneView)
                                    Functional Consequence:
                                    frameshift,coding_sequence_variant
                                    HGVS:
                                    NC_000007.14:g.37916419delG, NC_000007.13:g.37956021delG, NG_052980.1:g.5505delC, NM_003014.3:c.119delC, NP_003005.2:p.Thr40fs
                                    18.

                                    rs1486679589 [Homo sapiens]
                                      Variant type:
                                      SNV
                                      Alleles:
                                      T>A
                                      Chromosome:
                                      7:37917141
                                      Gene:
                                      SFRP4 (GeneView)
                                      Functional Consequence:
                                      upstream_transcript_variant
                                      Validated:
                                      by frequency
                                      Global MAF:
                                      A=0.0000/1 (TOPMED)
                                      HGVS:
                                      NC_000007.14:g.37917141T>A, NC_000007.13:g.37956743T>A, NG_052980.1:g.4783A>T
                                      19.

                                      rs1486446819 [Homo sapiens]
                                        Variant type:
                                        SNV
                                        Alleles:
                                        A>T
                                        Chromosome:
                                        7:37909537
                                        Gene:
                                        SFRP4 (GeneView)
                                        Functional Consequence:
                                        intron_variant
                                        Validated:
                                        by frequency,by cluster
                                        Global MAF:
                                        T=0.0000/1 (GnomAD)
                                        T=0.0000/1 (TOPMED)
                                        HGVS:
                                        NC_000007.14:g.37909537A>T, NC_000007.13:g.37949139A>T, NG_052980.1:g.12387T>A
                                        20.

                                        rs1486258112 [Homo sapiens]
                                          Variant type:
                                          SNV
                                          Alleles:
                                          C>T
                                          Chromosome:
                                          7:37907991
                                          Gene:
                                          SFRP4 (GeneView)
                                          Functional Consequence:
                                          intron_variant
                                          Validated:
                                          by frequency
                                          Global MAF:
                                          T=0.0000/1 (TOPMED)
                                          HGVS:
                                          NC_000007.14:g.37907991C>T, NC_000007.13:g.37947593C>T, NG_052980.1:g.13933G>A

                                          Display Settings:

                                          Format
                                          Items per page
                                          Sort by

                                          Send to:

                                          Choose Destination

                                          Supplemental Content

                                          Find related data

                                          Recent activity

                                          Your browsing activity is empty.

                                          Activity recording is turned off.

                                          Turn recording back on

                                          See more...
                                          Support Center