Display Settings:

Format

Send to:

Choose Destination
1.

rs84190040 [Taeniopygia guttata]
    TCCAACGTAAGAAGTGTCTGACTGG[A/C]TCAGCTTCACACCTCACTGATGCAG
    Chromosome:
    1:2101008
    Gene:
    LOC100226455 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center