Display Settings:

Format

Send to:

Choose Destination
1.

rs77245812 [Homo sapiens]
    TACACCTTGAATGCCGACAAGAAAA[C/T]GTGTTCAGGTGAGGCCTGTGTAGGG
    Chromosome:
    2:20003169
    Gene:
    LOC101928222 (GeneView) MATN3 (GeneView)
    Functional Consequence:
    intron variant,missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    other
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0140/70
    HGVS:
    NC_000002.11:g.20202930G>A, NC_000002.12:g.20003169G>A, NG_008087.1:g.14526C>T, NM_002381.4:c.908C>T, NP_002372.1:p.Thr303Met, NR_110235.1:n.364-851G>A, XM_005262615.1:c.791-1089C>T, XR_244593.1:n.288-851G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center