Display Settings:

Format

Send to:

Choose Destination
1.

rs398122861 [Homo sapiens]
    TTTACATCAACTGCTGTACTCGATC[A/C]GCCCCTTAACACGACTCGTATAAAT
    Chromosome:
    12:112455948
    Gene:
    PTPN11 (GeneView)
    Functional Consequence:
    splice acceptor variant
    Allele Origin:
    A(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000012.11:g.112893752A>C, NC_000012.12:g.112455948A>C, NG_007459.1:g.42217A>C, NM_001330437.1:c.643-2A>C, NM_002834.3:c.643-2A>C, NM_002834.4:c.643-2A>C, NM_080601.1:c.643-2A>C, NM_080601.2:c.643-2A>C, XM_006719526.2:c.643-2A>C, XM_011538613.2:c.640-2A>C, XM_017019722.1:c.640-2A>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center