Display Settings:

Format

Send to:

Choose Destination
1.

rs398089734 [Homo sapiens]
    ATATCATACCCTGATTCAAGTGGGT[-/T]ATTTATGTGAAATAGAAAAAACCGT
    Chromosome:
    1:186890544
    Gene:
    PLA2G4A (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info
    HGVS:
    CM000663.2:g.186890544_186890545insT, NC_000001.10:g.186859676_186859677insT, NC_000001.11:g.186890544_186890545insT, NG_012203.1:g.66645_66646insT, NM_001311193.1:c.116-2467_116-2466insT, NM_024420.2:c.116-2467_116-2466insT

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center