Display Settings:

Format

Send to:

Choose Destination
1.

rs397514532 [Homo sapiens]
    AATATTTAAAGAGTGCCTCCTGGGG[C/T]GGGAGAGCTCAGGTATGGGCCTGGA
    Chromosome:
    17:8075607
    Gene:
    ALOX12B (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000017.10:g.7978925G>A, NC_000017.11:g.8075607G>A, NG_007099.1:g.17097C>T, NM_001139.2:c.1642C>T, NP_001130.1:p.Arg548Trp

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center