Display Settings:

Format

Send to:

Choose Destination
1.

rs397509423 [Homo sapiens]
    GGCCTCTTCCTTCCAGCTGGGAATC[C/T]GAATCTCCATGTCCCATGAAGAGGA
    Chromosome:
    3:49723293
    Gene:
    GMPPB (GeneView)
    Functional Consequence:
    stop gained
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000003.11:g.49760726G>A, NC_000003.12:g.49723293G>A, NG_011603.1:g.38737G>A, NG_033731.1:g.5682C>T, NM_013334.3:c.220C>T, NM_021971.2:c.220C>T, NP_037466.2:p.Arg74Ter, NP_068806.1:p.Arg74Ter, XM_005265096.1:c.220C>T, XP_005265153.1:p.Arg74Ter

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center