Display Settings:

Format

Send to:

Choose Destination
1.

rs397509419 [Homo sapiens]
    CGACACAGGGCTGACCAGTTCTGCC[A/G]AAGTGTACAGCATCACAGACAACAA
    Chromosome:
    3:42689029
    Gene:
    KLHL40 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000003.11:g.42730521G>A, NC_000003.12:g.42689029G>A, NG_033035.1:g.8511G>A, NM_152393.3:c.1582G>A, NP_689606.2:p.Glu528Lys, XM_005264866.1:c.1474G>A, XP_005264923.1:p.Glu492Lys

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center