Display Settings:

Format

Send to:

Choose Destination
1.

rs397509418 [Homo sapiens]
    GAGAGAAATGTTGTTCACTCTGTAA[A/G]TTTTGTGTCCAATATAAACTATTTT
    Chromosome:
    4:183684059
    Gene:
    TRAPPC11 (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000004.11:g.184605212G>A, NC_000004.12:g.183684059G>A, NG_033102.1:g.29793G>A, NM_021942.5:c.1287+5G>A, NM_199053.2:c.1287+5G>A, XM_017008537.1:c.1287+5G>A, XM_017008538.1:c.1287+5G>A, XM_017008539.1:c.-64+5G>A, XR_001741315.1:n.1489+5G>A, XR_244637.1:n.1489+5G>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center