Display Settings:

Format

Send to:

Choose Destination
1.

rs397509411 [Homo sapiens]
    AGTTACAATTATGAAATTGTGAATC[A/G]GGCTTCCCTGGCTTGCGGCCCTATG
    Chromosome:
    14:102033136
    Gene:
    DYNC1H1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(de-novo,germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000014.8:g.102499473G>A, NC_000014.9:g.102033136G>A, NG_008777.1:g.73609G>A, NM_001376.4:c.10151G>A, NP_001367.2:p.Arg3384Gln

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center