Display Settings:

Format

Send to:

Choose Destination
1.

rs393692411 [Glycine max]
    TGTTGATTTTGGCCGACCTTTCGCA[C/T]GAATTGTAGTTGGGTCAGGGATAAG
    Chromosome:
    7:7429633
    Gene:
    LOC100818648 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    no info

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center