Display Settings:

Format

Send to:

Choose Destination
1.

rs393692410 [Glycine max]
    ACTACAATTTTAGTCATCTTATTTT[A/G]GAAAATCCATAATTTTGGTGTCTTA
    Chromosome:
    17:40994251
    Gene:
    LOC100811920 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by cluster

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center