Display Settings:

Format

Send to:

Choose Destination
1.

rs386834240 has merged into rs80044281 [Homo sapiens]
    GTTCAAATTAACTAAAACTGCAATG[A/C/T]GAGCCAATTATAAAAATAATTCCAA
    Chromosome:
    14:88416794
    Gene:
    SPATA7 (GeneView)
    Functional Consequence:
    stop gained,synonymous codon
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000014.8:g.88883138C>A, NC_000014.8:g.88883138C>T, NC_000014.9:g.88416794C>A, NC_000014.9:g.88416794C>T, NG_021183.1:g.36151C>A, NG_021183.1:g.36151C>T, NM_001040428.3:c.226C>A, NM_001040428.3:c.226C>T, NM_018418.4:c.322C>A, NM_018418.4:c.322C>T, NP_001035518.1:p.Arg76, NP_001035518.1:p.Arg76Ter, NP_060888.2:p.Arg108, NP_060888.2:p.Arg108Ter, XM_005267851.1:c.322C>A, XM_005267851.1:c.322C>T, XM_005267852.1:c.226C>A, XM_005267852.1:c.226C>T, XM_005267853.1:c.169C>A, XM_005267853.1:c.169C>T, XM_005267854.1:c.130C>A, XM_005267854.1:c.130C>T, XM_005267855.1:c.130C>A, XM_005267855.1:c.130C>T, XM_005267856.1:c.4C>A, XM_005267856.1:c.4C>T, XM_005267857.1:c.322C>A, XM_005267857.1:c.322C>T, XM_006720204.1:c.322C>A, XM_006720204.1:c.322C>T, XM_006720205.1:c.322C>A, XM_006720205.1:c.322C>T, XM_011536951.1:c.169C>A, XM_011536951.1:c.169C>T, XM_011536952.1:c.151C>A, XM_011536952.1:c.151C>T, XM_011536953.1:c.4C>A, XM_011536953.1:c.4C>T, XM_017021452.1:c.169C>A, XM_017021452.1:c.169C>T, XM_017021453.1:c.130C>A, XM_017021453.1:c.130C>T, XM_017021454.1:c.130C>A, XM_017021454.1:c.130C>T, XM_017021455.1:c.130C>A, XM_017021455.1:c.130C>T, XM_017021456.1:c.130C>A, XM_017021456.1:c.130C>T, XM_017021457.1:c.4C>A, XM_017021457.1:c.4C>T, XP_005267908.1:p.Arg108, XP_005267908.1:p.Arg108Ter, XP_005267909.1:p.Arg76, XP_005267909.1:p.Arg76Ter, XP_005267910.1:p.Arg57, XP_005267910.1:p.Arg57Ter, XP_005267911.1:p.Arg44, XP_005267911.1:p.Arg44Ter, XP_005267912.1:p.Arg44, XP_005267912.1:p.Arg44Ter, XP_005267913.1:p.Arg2, XP_005267913.1:p.Arg2Ter, XP_005267914.1:p.Arg108, XP_005267914.1:p.Arg108Ter, XP_006720267.1:p.Arg108, XP_006720267.1:p.Arg108Ter, XP_006720268.1:p.Arg108, XP_006720268.1:p.Arg108Ter, XP_011535253.1:p.Arg57, XP_011535253.1:p.Arg57Ter, XP_011535254.1:p.Arg51, XP_011535254.1:p.Arg51Ter, XP_011535255.1:p.Arg2, XP_011535255.1:p.Arg2Ter, XP_016876941.1:p.Arg57, XP_016876941.1:p.Arg57Ter, XP_016876942.1:p.Arg44, XP_016876942.1:p.Arg44Ter, XP_016876943.1:p.Arg44, XP_016876943.1:p.Arg44Ter, XP_016876944.1:p.Arg44, XP_016876944.1:p.Arg44Ter, XP_016876945.1:p.Arg44, XP_016876945.1:p.Arg44Ter, XP_016876946.1:p.Arg2, XP_016876946.1:p.Arg2Ter

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center