Display Settings:

Format

Send to:

Choose Destination
1.

rs386834227 [Homo sapiens]
    AAGTTCTTGGAGACTCACATCCTCA[A/G]AAATGAAAAAATCCCATGAGTTTCA
    Chromosome:
    1:169529635
    Gene:
    F5 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline,inherited)
    Clinical significance:
    Pathogenic
    Validated:
    no info
    HGVS:
    NC_000001.10:g.169498873C>T, NC_000001.11:g.169529635C>T, NG_011806.1:g.61897G>A, NM_000130.4:c.5392G>A, NP_000121.2:p.Glu1798Lys, XM_017000660.1:c.4981G>A, XP_016856149.1:p.Glu1661Lys

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center