Display Settings:

Format

Send to:

Choose Destination
1.

rs386352292 [Homo sapiens]
    GTGCCGCACATTGGCAAGTGTCTCC[A/G]GGAGATGTACACCACCCATGAGGAC
    Chromosome:
    15:101235167
    Gene:
    CHSY1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline,somatic)
    Clinical significance:
    Uncertain significance
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.0002/1
    HGVS:
    NC_000015.10:g.101235167C>T, NC_000015.9:g.101775372C>T, NG_031908.1:g.21766G>A, NM_014918.4:c.731G>A, NP_055733.2:p.Arg244Gln, XM_011521364.2:c.731G>A, XP_011519666.1:p.Arg244Gln

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center