Display Settings:

Format

Send to:

Choose Destination
1.

rs377712531 has merged into rs5776466 [Homo sapiens]
    GTTATATCTCCATTATATGTTCCAT[-/A]AAAAAAATGTGAATTTTCCTTTTTG
    Chromosome:
    1:99299637
    Gene:
    PLPPR4 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    -=0.0571/286
    HGVS:
    NC_000001.10:g.99765193delA, NC_000001.11:g.99299637delA, NM_001166252.1:c.734+407delA, NM_014839.4:c.734+407delA, XM_011542498.2:c.407+407delA

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center