Display Settings:

Format

Send to:

Choose Destination
1.

rs377452317 has merged into rs3833910 [Homo sapiens]
    AGGCTGATTAGTGAGTGGGGTCTGT[-/G]GGGGAGGAAGGGGGTTCCCTGCTTG
    Chromosome:
    12:110913226
    Gene:
    MYL2 (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    G(germline)/+.-----(germline)
    Clinical significance:
    untested
    Validated:
    no info
    Global MAF:
    -=0.2526/1265
    HGVS:
    NC_000012.11:g.111351030delC, NC_000012.12:g.110913226delC, NG_007554.1:g.12352delG, NM_000432.3:c.353+20delG

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center