Display Settings:

Format

Send to:

Choose Destination
1.

rs374515645 [Homo sapiens]
    TTGTACACCAGGCGACTGTCCCTCC[A/G]GAGACAAACTGCCCCCTGTCCCCTC
    Chromosome:
    11:119285348
    Gene:
    CBL (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Likely benign
    Validated:
    by cluster,by frequency
    HGVS:
    NC_000011.10:g.119285348A>G, NC_000011.9:g.119156058A>G, NG_016808.1:g.84069A>G, NM_005188.3:c.1723A>G, NP_005179.2:p.Arg575Gly, XM_005271718.1:c.1585A>G, XM_017018511.1:c.1243A>G, XP_005271775.1:p.Arg529Gly, XP_016874000.1:p.Arg415Gly

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center