Display Settings:

Format

Send to:

Choose Destination
1.

rs369078619 has merged into rs3212717 [Homo sapiens]
    ACAGGATTCGGTAGGAAGTGCCCCC[-/C]AGCCCCCAGGGATTGTACAATTTTA
    Chromosome:
    19:17843761
    Gene:
    JAK3 (GeneView)
    Functional Consequence:
    intron variant
    Allele Origin:
    C(germline)/+.-----(germline)
    Clinical significance:
    Benign
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    -=0.0168/84
    HGVS:
    NC_000019.10:g.17843761delG, NC_000019.9:g.17954570delG, NG_007273.1:g.9231delC, NM_000215.3:c.308+16delC, XM_005259896.1:c.437+16delC, XM_005259896.3:c.437+16delC, XM_011527990.1:c.437+16delC, XM_011527991.2:c.437+16delC

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center