Display Settings:

Format

Send to:

Choose Destination
1.

rs353408988 [Apis mellifera]
    ATACTATGTCATCAGCACGTTCGAG[C/T]TAAGTCGTTTCATATTTCAATGGAT
    Chromosome:
    LG9:10262991
    Gene:
    LOC100576167 (GeneView) LOC107964982 (GeneView)
    Functional Consequence:
    downstream variant 500B,synonymous codon
    Validated:
    no info

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center