Display Settings:

Format

Send to:

Choose Destination
1.

rs353408987 [Apis mellifera]
    TTCTCCAGCAACTGGAAGACAGTTT[A/G]CTTCTTGAAATAGCAACGAACAAGG
    Chromosome:
    LG9:10346460
    Gene:
    LOC411301 (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    no info

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center