Display Settings:

Format

Send to:

Choose Destination
1.

rs353408980 [Apis mellifera]
    GAAAAAACATTTTATCCCAATGCTT[C/G]CTATTCCTCCTTTACGTTTATCAAA
    Chromosome:
    LG9:8339631
    Gene:
    LOC411315 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    no info

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center