Display Settings:

Format

Send to:

Choose Destination
1.

rs35080474 [Homo sapiens]
    ATCTCTTTGTGATCTTCTTCATTGG[A/C]CTTGCCATCCATGGAGCTGAGTGAG
    Chromosome:
    X:37796121
    Gene:
    CYBB (GeneView)
    Functional Consequence:
    synonymous codon
    Allele Origin:
    A(germline)/C(germline)
    Clinical significance:
    Likely benign
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0037/14
    HGVS:
    NC_000023.10:g.37655374C>A, NC_000023.11:g.37796121C>A, NG_009065.1:g.21101C>A, NM_000397.3:c.654C>A, NP_000388.2:p.Gly218, NW_003871099.1:g.507927C>A, XM_005272588.1:c.558C>A, XP_005272645.1:p.Gly186

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center