Display Settings:

Format

Send to:

Choose Destination
1.

rs312262804 [Homo sapiens]
    GGGGTATACTGGATACACTCAAGGT[A/G]TCGGATTTAGGCGTATCTGTGTCAG
    Chromosome:
    X:13735349
    Gene:
    OFD1 (GeneView) TRAPPC2 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Allele Origin:
    G(unknown)/A(germline,unknown)
    Clinical significance:
    Benign
    Validated:
    no info
    HGVS:
    CM000685.2:g.13735349A>G, NC_000023.10:g.13753468A>G, NC_000023.11:g.13735349A>G, NG_008872.1:g.5637A>G, NG_011555.1:g.4275T>C, NM_001011658.3:c.-986T>C, NM_001128835.2:c.-878T>C, NM_001330209.1:c.111+3A>G, NM_001330210.1:c.-435+3A>G, NM_003611.2:c.111+3A>G, NM_014563.5:c.-844T>C, XR_247288.1:n.464+3A>G

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center