Display Settings:

Format

Send to:

Choose Destination
1.

rs281865555 [Homo sapiens]
    GACCAACGTCAAGGCCGCCTGGGGT[A/G]AGGTCGGCGCGCACGCTGGCGAGTA
    Chromosome:
    16:172961
    Gene:
    HBA2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    other
    Validated:
    by cluster
    HGVS:
    NC_000016.10:g.172961A>G, NC_000016.9:g.222960A>G, NG_000006.1:g.33824A>G, NM_000517.4:c.49A>G, NP_000508.1:p.Lys17Glu

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center