Display Settings:

Format

Send to:

Choose Destination
1.

rs281865542 has merged into rs12530380 [Homo sapiens]
    GCCATAGAGAAGAGGGATCACATCG[A/T]GGAGATGCAGCTGAGGCAGCACAAG
    Chromosome:
    6:32039810
    Gene:
    CYP21A2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by 2hit 2allele,by cluster,by frequency,by hapmap
    HGVS:
    NC_000006.11:g.32007587T>A, NC_000006.12:g.32039810T>A, NG_007941.3:g.6506T>A, NG_008337.2:g.74565A>T, NM_000500.7:c.713T>A, NM_001128590.3:c.623T>A, NP_000491.4:p.Val238Glu, NP_001122062.3:p.Val208Glu, NT_113891.2:g.3478238T>A, NT_113891.3:g.3478132T>A, NT_167245.1:g.3286803T>A, NT_167245.2:g.3281218T>A, NT_167247.1:g.3387428T>A, NT_167247.2:g.3381843T>A, NT_167249.1:g.3340295T>A, NT_167249.2:g.3340997T>A

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center